Mutagenetix > Incidental Mutations

Incidental Mutation 'R1355:Nlrp2'

156277

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

039420-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 5327491 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 635 (N635K)

Ref Sequence

ENSEMBL: ENSMUSP00000045077 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045022
AA Change: N635K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: N635K

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hist1h2bl	T	A	13: 21,715,857	Q96L	probably damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Plxna1	A	G	6: 89,320,766		probably benign	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Setdb2	T	A	14: 59,417,441	K333N	probably damaging	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Susd1	C	T	4: 59,424,114	C37Y	possibly damaging	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Uckl1	G	T	2: 181,573,376	T213K	probably damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGGAGACCATAGGACCTAAGATGCTTG -3'
(R):5'- ATCTGCCTCGGTATCCAGCAACTC -3'

Sequencing Primer
(F):5'- GGACCTAAGATGCTTGACTCTCAG -3'
(R):5'- ATTTGGCCTCCTGAATGAGAC -3'

Posted On

2014-02-11