Incidental Mutation 'R1355:Ccne1'
ID156278
Institutional Source Beutler Lab
Gene Symbol Ccne1
Ensembl Gene ENSMUSG00000002068
Gene Namecyclin E1
SynonymsCycE1, cyclin E
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1355 (G1)
Quality Score181
Status Validated
Chromosome7
Chromosomal Location38097984-38107534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38106322 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 43 (I43T)
Ref Sequence ENSEMBL: ENSMUSP00000103658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108023] [ENSMUST00000124979] [ENSMUST00000130329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108023
AA Change: I43T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103658
Gene: ENSMUSG00000002068
AA Change: I43T

DomainStartEndE-ValueType
CYCLIN 148 233 5.88e-26 SMART
Cyclin_C 242 364 2.36e-13 SMART
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124979
Predicted Effect possibly damaging
Transcript: ENSMUST00000130329
AA Change: I43T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117662
Gene: ENSMUSG00000002068
AA Change: I43T

DomainStartEndE-ValueType
Pfam:Cyclin_N 113 167 5.4e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Ccne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Ccne1 APN 7 38106301 missense probably benign 0.22
IGL02377:Ccne1 APN 7 38098990 critical splice donor site probably null
IGL02800:Ccne1 APN 7 38102799 missense probably damaging 1.00
R1938:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R4810:Ccne1 UTSW 7 38099593 missense probably damaging 1.00
R4858:Ccne1 UTSW 7 38099319 missense probably damaging 1.00
R4982:Ccne1 UTSW 7 38100571 missense probably damaging 1.00
R6480:Ccne1 UTSW 7 38106854 start gained probably benign
R6981:Ccne1 UTSW 7 38098573 unclassified probably benign
R7165:Ccne1 UTSW 7 38099301 missense probably damaging 1.00
R7398:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R7458:Ccne1 UTSW 7 38100671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCACATTGACAAGCTTCAGAG -3'
(R):5'- ATGACACCATGCCCTTGCAGAGAC -3'

Sequencing Primer
(F):5'- CATTGACAAGCTTCAGAGGTTCAG -3'
(R):5'- TTGCAGAGACTCGACGGAC -3'
Posted On2014-02-11