Incidental Mutation 'R1355:Olfr1537'
ID156286
Institutional Source Beutler Lab
Gene Symbol Olfr1537
Ensembl Gene ENSMUSG00000096109
Gene Nameolfactory receptor 1537
SynonymsMOR171-41P, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, Olfr1537-ps1, K4, MOR171-32P, Olfr144
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1355 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39234412-39249994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 39238251 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 58 (P58A)
Ref Sequence ENSEMBL: ENSMUSP00000149992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073248] [ENSMUST00000213472]
Predicted Effect probably benign
Transcript: ENSMUST00000073248
AA Change: P61A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072979
Gene: ENSMUSG00000096109
AA Change: P61A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.4e-51 PFAM
Pfam:7tm_1 44 293 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213472
AA Change: P58A

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Olfr1537
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr1537 APN 9 39237605 missense probably benign 0.25
IGL01691:Olfr1537 APN 9 39238019 missense probably benign 0.00
IGL02606:Olfr1537 APN 9 39238194 missense probably damaging 0.98
IGL02656:Olfr1537 APN 9 39238160 missense probably benign 0.13
R0133:Olfr1537 UTSW 9 39238011 missense probably benign 0.00
R0548:Olfr1537 UTSW 9 39238371 missense probably benign 0.13
R0558:Olfr1537 UTSW 9 39238200 missense probably damaging 0.96
R0616:Olfr1537 UTSW 9 39237650 missense probably benign 0.00
R0626:Olfr1537 UTSW 9 39237866 missense possibly damaging 0.52
R0826:Olfr1537 UTSW 9 39238429 start codon destroyed probably null 0.00
R0839:Olfr1537 UTSW 9 39237850 missense possibly damaging 0.51
R1074:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1224:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1226:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1252:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1256:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1356:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1416:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1499:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1658:Olfr1537 UTSW 9 39237959 missense probably benign 0.03
R1815:Olfr1537 UTSW 9 39237990 missense probably benign 0.01
R2198:Olfr1537 UTSW 9 39237752 missense possibly damaging 0.48
R4178:Olfr1537 UTSW 9 39238079 nonsense probably null
R5112:Olfr1537 UTSW 9 39238421 start codon destroyed probably null 0.94
R6251:Olfr1537 UTSW 9 39238218 missense possibly damaging 0.94
R6850:Olfr1537 UTSW 9 39237975 missense probably benign 0.01
R7032:Olfr1537 UTSW 9 39237687 missense possibly damaging 0.73
R7573:Olfr1537 UTSW 9 39237681 missense probably benign 0.42
R7715:Olfr1537 UTSW 9 39237878 missense probably damaging 1.00
R7722:Olfr1537 UTSW 9 39237589 nonsense probably null
R7729:Olfr1537 UTSW 9 39238250 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AACTTGCCCTCCCTGGAGTGAATG -3'
(R):5'- GGAAACCACTGCACAGTGACTGAG -3'

Sequencing Primer
(F):5'- ACATATCGGTCATAGGCCATTGC -3'
(R):5'- ACAGTGACTGAGTTCTTCTTAGC -3'
Posted On2014-02-11