Incidental Mutation 'R1355:Soga3'
ID 156288
Institutional Source Beutler Lab
Gene Symbol Soga3
Ensembl Gene ENSMUSG00000038916
Gene Name SOGA family member 3
Synonyms 6330407J23Rik
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R1355 (G1)
Quality Score 162
Status Validated
Chromosome 10
Chromosomal Location 29143839-29199630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29147322 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 222 (T222S)
Ref Sequence ENSEMBL: ENSMUSP00000090293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092629] [ENSMUST00000216757]
AlphaFold Q6NZL0
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070359
SMART Domains Protein: ENSMUSP00000063425
Gene: ENSMUSG00000056316

DomainStartEndE-ValueType
low complexity region 65 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092629
AA Change: T222S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000090293
Gene: ENSMUSG00000038916
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 214 247 N/A INTRINSIC
SCOP:d1fxkc_ 354 488 2e-4 SMART
Blast:BRLZ 356 384 6e-10 BLAST
Pfam:DUF3166 519 613 1.8e-34 PFAM
Pfam:DUF3166 639 727 4.6e-34 PFAM
transmembrane domain 917 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214863
Predicted Effect probably benign
Transcript: ENSMUST00000216757
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Soga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Soga3 APN 10 29196473 nonsense probably null
IGL00929:Soga3 APN 10 29148292 missense probably damaging 0.99
IGL01450:Soga3 APN 10 29196323 missense probably damaging 1.00
IGL01462:Soga3 APN 10 29148258 missense probably damaging 1.00
IGL03062:Soga3 APN 10 29198949 missense probably damaging 1.00
R0534:Soga3 UTSW 10 29180956 splice site probably benign
R1450:Soga3 UTSW 10 29147740 missense probably damaging 1.00
R1654:Soga3 UTSW 10 29146935 splice site probably null
R1680:Soga3 UTSW 10 29196839 missense probably damaging 1.00
R2134:Soga3 UTSW 10 29196399 nonsense probably null
R2570:Soga3 UTSW 10 29146765 missense possibly damaging 0.88
R4395:Soga3 UTSW 10 29147355 missense probably benign
R4859:Soga3 UTSW 10 29150394 missense probably benign 0.00
R4883:Soga3 UTSW 10 29196541 missense probably damaging 1.00
R4884:Soga3 UTSW 10 29196541 missense probably damaging 1.00
R5288:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5335:Soga3 UTSW 10 29147106 missense probably benign
R5384:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5385:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5457:Soga3 UTSW 10 29196724 missense probably benign 0.01
R5813:Soga3 UTSW 10 29150244 missense probably damaging 1.00
R5819:Soga3 UTSW 10 29197273 missense probably benign 0.00
R5950:Soga3 UTSW 10 29143648 unclassified probably benign
R6567:Soga3 UTSW 10 29147283 missense probably benign 0.00
R7312:Soga3 UTSW 10 29197244 missense probably damaging 1.00
R7313:Soga3 UTSW 10 29196879 nonsense probably null
R7445:Soga3 UTSW 10 29197003 missense possibly damaging 0.91
R7481:Soga3 UTSW 10 29196523 missense probably damaging 1.00
R7609:Soga3 UTSW 10 29148228 missense probably damaging 1.00
R7616:Soga3 UTSW 10 29146578 start gained probably benign
R7665:Soga3 UTSW 10 29196397 missense probably damaging 1.00
R8125:Soga3 UTSW 10 29196898 missense probably damaging 1.00
R8153:Soga3 UTSW 10 29148239 nonsense probably null
R8220:Soga3 UTSW 10 29147268 nonsense probably null
R8260:Soga3 UTSW 10 29148274 missense possibly damaging 0.91
R8749:Soga3 UTSW 10 29196725 missense possibly damaging 0.95
R9225:Soga3 UTSW 10 29196331 nonsense probably null
R9364:Soga3 UTSW 10 29196779 missense probably damaging 0.98
R9484:Soga3 UTSW 10 29196973 missense probably damaging 1.00
R9518:Soga3 UTSW 10 29146752 missense probably benign
R9546:Soga3 UTSW 10 29146809 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATACCCAAAGGGGCTGTTCCCG -3'
(R):5'- TACAAGGGGCTCACAGATGGCTGG -3'

Sequencing Primer
(F):5'- TCCGCTCgggggagtag -3'
(R):5'- GCCGCCACCGTTTTTAGTG -3'
Posted On 2014-02-11