Incidental Mutation 'R1355:Eml6'
ID 156290
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Name echinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 29743048-30026033 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 29833085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 599 (S599R)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
AlphaFold Q5SQM0
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: S599R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: S599R

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
R7615:Eml6 UTSW 11 29802501 missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29753085 missense probably damaging 0.98
R7980:Eml6 UTSW 11 29833205 missense probably damaging 1.00
R8026:Eml6 UTSW 11 29749973 missense possibly damaging 0.63
R8046:Eml6 UTSW 11 29758981 missense probably damaging 0.99
R8049:Eml6 UTSW 11 29893201 missense possibly damaging 0.95
R8114:Eml6 UTSW 11 29754910 missense probably damaging 1.00
R8425:Eml6 UTSW 11 29755008 missense probably benign 0.00
R8799:Eml6 UTSW 11 29758981 missense probably benign 0.11
R8945:Eml6 UTSW 11 29753110 missense probably damaging 0.98
R8977:Eml6 UTSW 11 29784182 missense possibly damaging 0.59
R8986:Eml6 UTSW 11 29805181 missense possibly damaging 0.92
R9088:Eml6 UTSW 11 29818424 missense probably damaging 0.96
R9150:Eml6 UTSW 11 29805791 missense probably benign 0.15
R9209:Eml6 UTSW 11 29831175 missense probably damaging 1.00
R9288:Eml6 UTSW 11 29838641 critical splice acceptor site probably null
R9467:Eml6 UTSW 11 29819076 missense probably damaging 0.99
R9481:Eml6 UTSW 11 29838641 critical splice acceptor site probably null
R9534:Eml6 UTSW 11 29784155 missense possibly damaging 0.45
RF037:Eml6 UTSW 11 29752549 critical splice acceptor site probably benign
RF039:Eml6 UTSW 11 29752551 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CCCACCTTATCTCTTTAGCTCCAGAACA -3'
(R):5'- TGAAGCTGTGTGCATTGGTTGGAATA -3'

Sequencing Primer
(F):5'- agaaaagaaaggaaaagagaaggg -3'
(R):5'- AAGCATTTAGCCGTAGAGCTTG -3'
Posted On 2014-02-11