Incidental Mutation 'R1355:Atp10b'
ID 156291
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 5930426O13Rik, 9030605H24Rik
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 43149877-43262285 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 43151655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 14 (W14*)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably null
Transcript: ENSMUST00000077659
AA Change: W14*
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: W14*

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148911
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43202161 missense probably damaging 1.00
IGL01385:Atp10b APN 11 43234429 missense probably damaging 1.00
IGL01524:Atp10b APN 11 43259845 missense probably benign 0.18
IGL01575:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01588:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01590:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01832:Atp10b APN 11 43234435 missense probably damaging 0.98
IGL01927:Atp10b APN 11 43259404 splice site probably benign
IGL01933:Atp10b APN 11 43194630 missense probably damaging 1.00
IGL02182:Atp10b APN 11 43248947 missense probably damaging 1.00
IGL02215:Atp10b APN 11 43194665 critical splice donor site probably null
IGL02216:Atp10b APN 11 43259789 missense probably damaging 0.98
IGL02973:Atp10b APN 11 43197509 missense probably damaging 1.00
IGL03012:Atp10b APN 11 43194655 missense probably damaging 0.99
IGL03106:Atp10b APN 11 43247477 missense probably benign 0.32
IGL03123:Atp10b APN 11 43153283 missense probably benign 0.01
IGL03202:Atp10b APN 11 43234441 critical splice donor site probably null
IGL03339:Atp10b APN 11 43230615 missense probably null 0.71
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0281:Atp10b UTSW 11 43153304 missense probably benign 0.00
R0379:Atp10b UTSW 11 43254314 missense probably benign 0.05
R0380:Atp10b UTSW 11 43225597 missense probably damaging 1.00
R0470:Atp10b UTSW 11 43203039 missense possibly damaging 0.88
R1368:Atp10b UTSW 11 43202154 missense probably damaging 1.00
R1370:Atp10b UTSW 11 43151655 nonsense probably null
R1413:Atp10b UTSW 11 43230564 missense probably benign 0.00
R1502:Atp10b UTSW 11 43230347 missense probably damaging 1.00
R1530:Atp10b UTSW 11 43197524 missense probably benign 0.03
R1596:Atp10b UTSW 11 43235767 missense probably damaging 1.00
R1675:Atp10b UTSW 11 43225648 missense probably damaging 1.00
R1880:Atp10b UTSW 11 43259432 missense probably damaging 1.00
R1938:Atp10b UTSW 11 43230418 missense probably benign 0.00
R1986:Atp10b UTSW 11 43172768 missense probably benign 0.12
R2081:Atp10b UTSW 11 43202128 missense probably damaging 1.00
R2083:Atp10b UTSW 11 43212423 missense probably benign 0.24
R2159:Atp10b UTSW 11 43151853 missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43234380 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43172745 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43189613 missense probably damaging 1.00
R3741:Atp10b UTSW 11 43235662 missense probably damaging 1.00
R3942:Atp10b UTSW 11 43172754 missense probably damaging 1.00
R3971:Atp10b UTSW 11 43216512 missense probably damaging 1.00
R4007:Atp10b UTSW 11 43259852 missense probably benign 0.04
R4050:Atp10b UTSW 11 43259536 missense probably benign 0.00
R4078:Atp10b UTSW 11 43153283 missense probably benign 0.01
R4567:Atp10b UTSW 11 43197557 missense probably benign 0.03
R4651:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4652:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4667:Atp10b UTSW 11 43247518 missense probably damaging 1.00
R4720:Atp10b UTSW 11 43203122 missense probably benign
R4987:Atp10b UTSW 11 43151613 utr 5 prime probably benign
R5232:Atp10b UTSW 11 43202179 missense probably damaging 1.00
R5233:Atp10b UTSW 11 43230560 missense probably benign 0.06
R5281:Atp10b UTSW 11 43254336 missense probably damaging 0.97
R5307:Atp10b UTSW 11 43212475 missense probably damaging 1.00
R5460:Atp10b UTSW 11 43230455 missense probably benign 0.00
R5518:Atp10b UTSW 11 43151636 missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43245425 missense probably damaging 1.00
R5688:Atp10b UTSW 11 43201173 missense probably benign 0.00
R5735:Atp10b UTSW 11 43151774 missense probably benign 0.00
R6153:Atp10b UTSW 11 43254282 missense probably damaging 1.00
R6251:Atp10b UTSW 11 43235746 missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43201238 missense probably benign 0.24
R6394:Atp10b UTSW 11 43225637 missense probably damaging 1.00
R6492:Atp10b UTSW 11 43218957 missense probably damaging 1.00
R6769:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6771:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6775:Atp10b UTSW 11 43222213 missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43245464 missense probably damaging 1.00
R7322:Atp10b UTSW 11 43212547 missense probably damaging 1.00
R7367:Atp10b UTSW 11 43247501 missense probably damaging 1.00
R7538:Atp10b UTSW 11 43225546 missense probably benign 0.04
R7708:Atp10b UTSW 11 43202143 missense probably damaging 1.00
R7787:Atp10b UTSW 11 43259873 missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43202122 missense probably damaging 1.00
R8406:Atp10b UTSW 11 43203157 missense probably benign 0.00
R8503:Atp10b UTSW 11 43222239 missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43230381 missense probably benign 0.18
R8744:Atp10b UTSW 11 43230350 missense probably damaging 1.00
R8815:Atp10b UTSW 11 43203151 missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43222159 missense probably damaging 1.00
R8880:Atp10b UTSW 11 43215984 missense probably benign
R8989:Atp10b UTSW 11 43245442 nonsense probably null
R8998:Atp10b UTSW 11 43259899 makesense probably null
R9255:Atp10b UTSW 11 43216321 missense probably damaging 1.00
R9281:Atp10b UTSW 11 43225631 missense probably benign 0.11
R9345:Atp10b UTSW 11 43203197 missense probably damaging 0.99
R9357:Atp10b UTSW 11 43259884 missense probably benign 0.18
R9393:Atp10b UTSW 11 43172781 missense probably damaging 1.00
R9516:Atp10b UTSW 11 43230397 missense probably benign 0.02
Z1177:Atp10b UTSW 11 43153349 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACACCATCACTTGCTTTCACAATGC -3'
(R):5'- AGACCTTCTTCCAGTCCTGGTGAC -3'

Sequencing Primer
(F):5'- CACAATGCTGATCCTTGTGG -3'
(R):5'- AGTCCTGGTGACACATGCTG -3'
Posted On 2014-02-11