Mutagenetix > Incidental Mutations

Incidental Mutation 'R1355:Hist1h2bl'

156294

Institutional Source

Beutler Lab

Gene Symbol

Hist1h2bl

Ensembl Gene

ENSMUSG00000094338

Gene Name

histone cluster 1, H2bl

Synonyms

MMRRC Submission

039420-MU

Accession Numbers

Is this an essential gene?

Not available question?

Stock #

R1355 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

21715763-21716143 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21715857 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 96 (Q96L)

Ref Sequence

ENSEMBL: ENSMUSP00000089350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070124] [ENSMUST00000091756] [ENSMUST00000188775]

Predicted Effect

probably benign
Transcript: ENSMUST00000070124

SMART Domains

Protein: ENSMUSP00000088285
Gene: ENSMUSG00000071516

Domain	Start	End	E-Value	Type
H2A	3	123	8.07e-81	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091756
AA Change: Q96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089350
Gene: ENSMUSG00000094338
AA Change: Q96L

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
H2B	28	124	4.64e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188775

SMART Domains

Protein: ENSMUSP00000140394
Gene: ENSMUSG00000101355

Domain	Start	End	E-Value	Type
H3	34	136	1.5e-75	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196836

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Nlrp2	G	T	7: 5,327,491	N635K	possibly damaging	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Plxna1	A	G	6: 89,320,766		probably benign	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Setdb2	T	A	14: 59,417,441	K333N	probably damaging	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Susd1	C	T	4: 59,424,114	C37Y	possibly damaging	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Uckl1	G	T	2: 181,573,376	T213K	probably damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Hist1h2bl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01347:Hist1h2bl	APN	13	21715894	missense	probably damaging	1.00
R0482:Hist1h2bl	UTSW	13	21716125	unclassified	probably benign
R1341:Hist1h2bl	UTSW	13	21716110	missense	probably benign	0.09
R4793:Hist1h2bl	UTSW	13	21715918	missense	probably benign	0.00
R4816:Hist1h2bl	UTSW	13	21715965	missense	probably benign	0.32
R4842:Hist1h2bl	UTSW	13	21716064	unclassified	probably benign
R4917:Hist1h2bl	UTSW	13	21716019	missense	probably damaging	0.97
R5355:Hist1h2bl	UTSW	13	21715860	missense	probably damaging	1.00
R6036:Hist1h2bl	UTSW	13	21715978	missense	probably damaging	0.99
R6036:Hist1h2bl	UTSW	13	21715978	missense	probably damaging	0.99
R7546:Hist1h2bl	UTSW	13	21715870	missense	probably benign	0.19
R7972:Hist1h2bl	UTSW	13	21715807	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- GCAAAGCCTGACTGTCCATTAACCC -3'
(R):5'- CGTGTACAAGGTGCTGAAGCAAGTG -3'

Sequencing Primer
(F):5'- CTTGTTAGGTCCAAGGCAAGAG -3'
(R):5'- AACGACATCTTCGAGCGCAT -3'

Posted On

2014-02-11