Incidental Mutation 'R1355:Hist1h2bl'
ID 156294
Institutional Source Beutler Lab
Gene Symbol Hist1h2bl
Ensembl Gene ENSMUSG00000094338
Gene Name histone cluster 1, H2bl
Synonyms
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock # R1355 (G1)
Quality Score 88
Status Not validated
Chromosome 13
Chromosomal Location 21715763-21716143 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21715857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 96 (Q96L)
Ref Sequence ENSEMBL: ENSMUSP00000089350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070124] [ENSMUST00000091756] [ENSMUST00000188775]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070124
SMART Domains Protein: ENSMUSP00000088285
Gene: ENSMUSG00000071516

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091756
AA Change: Q96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089350
Gene: ENSMUSG00000094338
AA Change: Q96L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188775
SMART Domains Protein: ENSMUSP00000140394
Gene: ENSMUSG00000101355

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196836
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Hist1h2bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Hist1h2bl APN 13 21715894 missense probably damaging 1.00
R0482:Hist1h2bl UTSW 13 21716125 unclassified probably benign
R1341:Hist1h2bl UTSW 13 21716110 missense probably benign 0.09
R4793:Hist1h2bl UTSW 13 21715918 missense probably benign 0.00
R4816:Hist1h2bl UTSW 13 21715965 missense probably benign 0.32
R4842:Hist1h2bl UTSW 13 21716064 unclassified probably benign
R4917:Hist1h2bl UTSW 13 21716019 missense probably damaging 0.97
R5355:Hist1h2bl UTSW 13 21715860 missense probably damaging 1.00
R6036:Hist1h2bl UTSW 13 21715978 missense probably damaging 0.99
R6036:Hist1h2bl UTSW 13 21715978 missense probably damaging 0.99
R7546:Hist1h2bl UTSW 13 21715870 missense probably benign 0.19
R7972:Hist1h2bl UTSW 13 21715807 missense possibly damaging 0.60
R8546:Hist1h2bl UTSW 13 21715872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGCCTGACTGTCCATTAACCC -3'
(R):5'- CGTGTACAAGGTGCTGAAGCAAGTG -3'

Sequencing Primer
(F):5'- CTTGTTAGGTCCAAGGCAAGAG -3'
(R):5'- AACGACATCTTCGAGCGCAT -3'
Posted On 2014-02-11