Mutagenetix > Incidental Mutations

Incidental Mutation 'R1355:Setdb2'

156295

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

039420-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.628) question?

Stock #

R1355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59417441 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 333 (K333N)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: K333N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: K333N

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161459
AA Change: K317N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: K317N

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Meta Mutation Damage Score

0.1571

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hist1h2bl	T	A	13: 21,715,857	Q96L	probably damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Nlrp2	G	T	7: 5,327,491	N635K	possibly damaging	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Plxna1	A	G	6: 89,320,766		probably benign	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Susd1	C	T	4: 59,424,114	C37Y	possibly damaging	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Uckl1	G	T	2: 181,573,376	T213K	probably damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCAGCAGAGTGAATACACTCCAAT -3'
(R):5'- GGCCTACCTTGTTTAGAGAGGTTTCCA -3'

Sequencing Primer
(F):5'- caggcagacagcagagac -3'
(R):5'- GTTGACAGCAAAGAATGCCAAG -3'

Posted On

2014-02-11