Mutagenetix > Incidental Mutation

Incidental Mutation 'R1355:Pros1'

156300

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

039420-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62919558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 457 (K457E)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably benign
Transcript: ENSMUST00000023629
AA Change: K457E

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: K457E

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127502

Meta Mutation Damage Score

0.1583

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hist1h2bl	T	A	13: 21,715,857	Q96L	probably damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Nlrp2	G	T	7: 5,327,491	N635K	possibly damaging	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Plxna1	A	G	6: 89,320,766		probably benign	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Setdb2	T	A	14: 59,417,441	K333N	probably damaging	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Susd1	C	T	4: 59,424,114	C37Y	possibly damaging	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Uckl1	G	T	2: 181,573,376	T213K	probably damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ATCTTGAACCTGCCTGGATGCG -3'
(R):5'- GGCCTGTCATAGCAACTAGTCACTG -3'

Sequencing Primer
(F):5'- AGATTAGAATCTTCCTGGGCCAC -3'
(R):5'- TAGTCACTGGGCAATGCTAAC -3'

Posted On

2014-02-11