Incidental Mutation 'R1355:Cryzl1'
ID 156302
Institutional Source Beutler Lab
Gene Symbol Cryzl1
Ensembl Gene ENSMUSG00000058240
Gene Name crystallin, zeta (quinone reductase)-like 1
Synonyms
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 91689322-91728975 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91692658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000113227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000073466] [ENSMUST00000114023] [ENSMUST00000114031] [ENSMUST00000117159] [ENSMUST00000117644] [ENSMUST00000122254] [ENSMUST00000124282] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000144877] [ENSMUST00000144461] [ENSMUST00000145833] [ENSMUST00000159295] [ENSMUST00000231499]
AlphaFold Q921W4
Predicted Effect probably benign
Transcript: ENSMUST00000023682
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073466
AA Change: V281A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073171
Gene: ENSMUSG00000058240
AA Change: V281A

DomainStartEndE-ValueType
Pfam:ADH_N 30 142 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114023
SMART Domains Protein: ENSMUSP00000109656
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 140 2e-8 PFAM
Pfam:ADH_zinc_N 156 231 5.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114031
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117159
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117644
AA Change: V266A

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113227
Gene: ENSMUSG00000058240
AA Change: V266A

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 141 212 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122254
SMART Domains Protein: ENSMUSP00000112734
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 71 150 1e-9 BLAST
SCOP:d1heta1 73 137 4e-12 SMART
low complexity region 172 190 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123893
Predicted Effect probably benign
Transcript: ENSMUST00000124282
AA Change: V281A

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115686
Gene: ENSMUSG00000058240
AA Change: V281A

DomainStartEndE-ValueType
Pfam:ADH_N 30 150 1.7e-8 PFAM
Pfam:ADH_zinc_N 156 227 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect probably benign
Transcript: ENSMUST00000138560
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139324
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156242
Predicted Effect probably benign
Transcript: ENSMUST00000144461
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144472
SMART Domains Protein: ENSMUSP00000116833
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 2 152 8e-13 BLAST
PDB:3SLK|B 2 152 3e-10 PDB
SCOP:d1heta1 24 103 1e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232491
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231499
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to zeta crystallin, also known as quinone oxidoreductase. This zeta crystallin-like protein also contains an NAD(P)H binding site. Alternatively spliced transcript variants have been observed but their full-length nature has not been completely determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Cryzl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Cryzl1 APN 16 91712251 missense possibly damaging 0.90
IGL02937:Cryzl1 APN 16 91690731 missense possibly damaging 0.62
R0360:Cryzl1 UTSW 16 91707267 missense probably benign 0.00
R0364:Cryzl1 UTSW 16 91707267 missense probably benign 0.00
R0513:Cryzl1 UTSW 16 91699287 missense possibly damaging 0.87
R0630:Cryzl1 UTSW 16 91707219 splice site probably benign
R1370:Cryzl1 UTSW 16 91692658 missense possibly damaging 0.48
R1709:Cryzl1 UTSW 16 91712236 missense probably damaging 0.99
R2284:Cryzl1 UTSW 16 91694305 unclassified probably benign
R5321:Cryzl1 UTSW 16 91707230 missense probably benign 0.01
R5768:Cryzl1 UTSW 16 91695354 missense probably damaging 1.00
R6468:Cryzl1 UTSW 16 91692525 splice site probably null
R7372:Cryzl1 UTSW 16 91712197 missense probably benign 0.24
R8319:Cryzl1 UTSW 16 91692363 missense probably benign
R8481:Cryzl1 UTSW 16 91707273 nonsense probably null
R8830:Cryzl1 UTSW 16 91712204 missense probably benign 0.39
R8886:Cryzl1 UTSW 16 91695300 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGTAGCCTCTCACCTGTGAAATGG -3'
(R):5'- AGCTTGTAGCAAGTGCTATGCTTCC -3'

Sequencing Primer
(F):5'- TGGAGCTACATTACTCAGGCATC -3'
(R):5'- GCAAGTGCTATGCTTCCTACAATG -3'
Posted On 2014-02-11