Incidental Mutation 'R1355:Ppp4r1'
ID 156304
Institutional Source Beutler Lab
Gene Symbol Ppp4r1
Ensembl Gene ENSMUSG00000061950
Gene Name protein phosphatase 4, regulatory subunit 1
Synonyms Pp4r1, 3110001J10Rik
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 65782573-65841926 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65840987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 924 (E924D)
Ref Sequence ENSEMBL: ENSMUSP00000124690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073104] [ENSMUST00000160664] [ENSMUST00000162109] [ENSMUST00000162703]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073104
AA Change: E941D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072848
Gene: ENSMUSG00000061950
AA Change: E941D

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 213 244 2e-5 PFAM
Pfam:HEAT 253 280 2.7e-6 PFAM
low complexity region 531 540 N/A INTRINSIC
PDB:3FGA|A 664 930 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097293
Predicted Effect probably benign
Transcript: ENSMUST00000160664
AA Change: E924D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124690
Gene: ENSMUSG00000061950
AA Change: E924D

DomainStartEndE-ValueType
low complexity region 135 146 N/A INTRINSIC
Pfam:HEAT 236 263 2.2e-6 PFAM
low complexity region 514 523 N/A INTRINSIC
PDB:3FGA|A 647 913 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162109
SMART Domains Protein: ENSMUSP00000125220
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 253 280 7.1e-7 PFAM
Pfam:HEAT 292 322 2.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162703
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Ppp4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ppp4r1 APN 17 65816019 missense probably benign 0.06
IGL01415:Ppp4r1 APN 17 65813527 missense probably damaging 1.00
IGL02166:Ppp4r1 APN 17 65813492 missense probably benign 0.01
IGL02672:Ppp4r1 APN 17 65840947 missense probably damaging 1.00
estancia UTSW 17 65803968 critical splice donor site probably null
Hacienda UTSW 17 65816006 missense probably benign
R0304:Ppp4r1 UTSW 17 65816006 missense probably benign
R0976:Ppp4r1 UTSW 17 65841018 makesense probably null
R2356:Ppp4r1 UTSW 17 65833050 missense probably damaging 0.99
R2405:Ppp4r1 UTSW 17 65811346 missense possibly damaging 0.95
R3054:Ppp4r1 UTSW 17 65836079 missense probably damaging 0.99
R4391:Ppp4r1 UTSW 17 65824754 missense probably benign 0.05
R4603:Ppp4r1 UTSW 17 65813464 missense probably damaging 1.00
R4763:Ppp4r1 UTSW 17 65835110 missense possibly damaging 0.90
R5571:Ppp4r1 UTSW 17 65803861 nonsense probably null
R5586:Ppp4r1 UTSW 17 65824568 missense probably benign 0.00
R5661:Ppp4r1 UTSW 17 65803968 critical splice donor site probably null
R5742:Ppp4r1 UTSW 17 65837746 missense probably damaging 0.97
R5971:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6079:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6138:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6303:Ppp4r1 UTSW 17 65824729 missense probably benign 0.10
R6684:Ppp4r1 UTSW 17 65824342 missense probably benign 0.00
R7058:Ppp4r1 UTSW 17 65829500 missense probably benign 0.00
R7397:Ppp4r1 UTSW 17 65837791 missense probably benign 0.28
R7448:Ppp4r1 UTSW 17 65840941 missense probably damaging 1.00
R7465:Ppp4r1 UTSW 17 65831020 nonsense probably null
R7528:Ppp4r1 UTSW 17 65813498 missense probably damaging 1.00
R7571:Ppp4r1 UTSW 17 65810616 missense possibly damaging 0.91
R7910:Ppp4r1 UTSW 17 65811303 missense probably benign 0.00
R7910:Ppp4r1 UTSW 17 65829399 missense probably damaging 1.00
R7972:Ppp4r1 UTSW 17 65833098 missense possibly damaging 0.90
R8910:Ppp4r1 UTSW 17 65837773 missense probably damaging 1.00
R8915:Ppp4r1 UTSW 17 65829381 missense probably damaging 0.99
R8939:Ppp4r1 UTSW 17 65803931 missense probably damaging 1.00
R9515:Ppp4r1 UTSW 17 65835078 missense probably null 1.00
R9557:Ppp4r1 UTSW 17 65803263 missense probably benign 0.04
U15987:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
Z1176:Ppp4r1 UTSW 17 65838926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTATTGTGCAGGCAGCGAGC -3'
(R):5'- TGCCAATTCAAGCCATCAGTCAGG -3'

Sequencing Primer
(F):5'- GCACCTGACTGTACTTGACTAAAC -3'
(R):5'- TCTCTTGACTCTTAAAACCACTGG -3'
Posted On 2014-02-11