Incidental Mutation 'R1355:Cyp2c68'
ID 156309
Institutional Source Beutler Lab
Gene Symbol Cyp2c68
Ensembl Gene ENSMUSG00000074882
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms 9030012A22Rik
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 39688834-39741054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39740956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 29 (L29P)
Ref Sequence ENSEMBL: ENSMUSP00000097071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099472]
AlphaFold K7N6C2
Predicted Effect probably damaging
Transcript: ENSMUST00000099472
AA Change: L29P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097071
Gene: ENSMUSG00000074882
AA Change: L29P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-150 PFAM
Meta Mutation Damage Score 0.2722 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Cyp2c68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Cyp2c68 APN 19 39712495 missense probably damaging 0.98
IGL00826:Cyp2c68 APN 19 39739505 missense possibly damaging 0.87
IGL01363:Cyp2c68 APN 19 39703427 missense probably benign 0.01
IGL01892:Cyp2c68 APN 19 39734344 missense probably benign 0.00
IGL02088:Cyp2c68 APN 19 39703521 splice site probably benign
IGL02422:Cyp2c68 APN 19 39734452 missense probably damaging 1.00
IGL03047:Cyp2c68 UTSW 19 39734460 missense probably benign 0.00
R0523:Cyp2c68 UTSW 19 39739429 missense probably benign 0.08
R0729:Cyp2c68 UTSW 19 39739550 splice site probably benign
R0975:Cyp2c68 UTSW 19 39703358 missense possibly damaging 0.85
R1117:Cyp2c68 UTSW 19 39712459 missense probably damaging 1.00
R1370:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1436:Cyp2c68 UTSW 19 39741040 start codon destroyed probably null 1.00
R1564:Cyp2c68 UTSW 19 39735580 nonsense probably null
R1730:Cyp2c68 UTSW 19 39699275 missense possibly damaging 0.87
R1865:Cyp2c68 UTSW 19 39734289 missense probably benign 0.04
R1905:Cyp2c68 UTSW 19 39735582 missense probably benign 0.01
R1951:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R1952:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R2224:Cyp2c68 UTSW 19 39735582 missense probably benign 0.34
R2230:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2231:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2866:Cyp2c68 UTSW 19 39689145 missense probably damaging 1.00
R3104:Cyp2c68 UTSW 19 39734313 missense probably benign
R4409:Cyp2c68 UTSW 19 39739452 missense probably damaging 0.98
R4575:Cyp2c68 UTSW 19 39734361 missense probably benign 0.21
R4620:Cyp2c68 UTSW 19 39712562 splice site probably null
R4684:Cyp2c68 UTSW 19 39699335 missense possibly damaging 0.48
R5023:Cyp2c68 UTSW 19 39712507 missense probably benign 0.01
R5410:Cyp2c68 UTSW 19 39699284 missense possibly damaging 0.65
R5513:Cyp2c68 UTSW 19 39703406 missense probably damaging 1.00
R5568:Cyp2c68 UTSW 19 39689082 missense probably benign 0.19
R5706:Cyp2c68 UTSW 19 39734318 missense possibly damaging 0.95
R5890:Cyp2c68 UTSW 19 39712492 missense probably damaging 1.00
R5897:Cyp2c68 UTSW 19 39712531 missense probably benign 0.01
R6007:Cyp2c68 UTSW 19 39734336 missense probably damaging 1.00
R6132:Cyp2c68 UTSW 19 39703414 missense possibly damaging 0.90
R6187:Cyp2c68 UTSW 19 39741008 missense probably benign 0.32
R6229:Cyp2c68 UTSW 19 39739178 missense probably benign 0.02
R6341:Cyp2c68 UTSW 19 39712489 missense possibly damaging 0.54
R7209:Cyp2c68 UTSW 19 39689205 missense probably damaging 1.00
R7330:Cyp2c68 UTSW 19 39689190 missense probably damaging 1.00
R7374:Cyp2c68 UTSW 19 39739204 critical splice acceptor site probably null
R7402:Cyp2c68 UTSW 19 39740874 missense probably benign 0.02
R7483:Cyp2c68 UTSW 19 39689137 missense probably benign 0.02
R9103:Cyp2c68 UTSW 19 39739181 missense possibly damaging 0.95
R9204:Cyp2c68 UTSW 19 39739127 missense probably damaging 1.00
R9452:Cyp2c68 UTSW 19 39699389 missense possibly damaging 0.75
Z1088:Cyp2c68 UTSW 19 39739463 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTTGATGGGGAAAATACGACAGATGC -3'
(R):5'- ACATGTCTTACAGGCACGCTACAAA -3'

Sequencing Primer
(F):5'- GGTACTTCAATCTGAAACTTAGAGC -3'
(R):5'- GGCACGCTACAAAAATGACAATG -3'
Posted On 2014-02-11