Mutagenetix > Incidental Mutations

Incidental Mutation 'R1356:Abca12'

156312

Institutional Source

Beutler Lab

Gene Symbol

Abca12

Ensembl Gene

ENSMUSG00000050296

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 12

Synonyms

4833417A11Rik, 4832428G11Rik

MMRRC Submission

039421-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1356 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71242276-71414910 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 71302953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000084523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087268]

AlphaFold

E9Q876

Predicted Effect

probably benign
Transcript: ENSMUST00000087268

SMART Domains

Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296

Domain	Start	End	E-Value	Type
transmembrane domain	24	43	N/A	INTRINSIC
low complexity region	246	259	N/A	INTRINSIC
Pfam:ABC2_membrane_3	885	1267	2.9e-24	PFAM
AAA	1370	1554	4.2e-10	SMART
low complexity region	1717	1735	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1744	2206	9.6e-35	PFAM
AAA	2282	2467	4.61e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188752

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	A	G	8: 24,668,595		probably benign	Het
Cd274	C	A	19: 29,373,570	T22K	possibly damaging	Het
Cfap45	G	A	1: 172,527,863	R26Q	possibly damaging	Het
Dvl3	AGCGGCGGCGGCGG	AGCGGCGGCGG	16: 20,524,305		probably benign	Het
E2f8	A	G	7: 48,880,270		probably benign	Het
Ercc4	A	G	16: 13,125,282	H255R	probably damaging	Het
Fam227b	C	T	2: 126,119,008	D234N	probably damaging	Het
Foxp1	A	T	6: 99,016,676		probably benign	Het
Fsip2	T	A	2: 82,989,745	V5274D	probably benign	Het
Gm21718	A	G	14: 51,316,647		noncoding transcript	Het
Gpr85	G	A	6: 13,836,147	P253S	probably benign	Het
Grm7	A	T	6: 111,359,024	I799F	probably damaging	Het
Inpp1	A	G	1: 52,797,056	F84L	possibly damaging	Het
Kprp	T	A	3: 92,825,602	E47V	probably damaging	Het
Krt9	CTGC	CTGCNNNNNNNNNNNNNNNNNNNNNTGC	11: 100,188,814		probably benign	Het
Lama3	G	A	18: 12,500,577		probably benign	Het
Lurap1l	C	G	4: 80,911,530	A59G	probably benign	Het
Macc1	A	T	12: 119,446,555	T353S	probably benign	Het
Mctp2	A	G	7: 72,164,723		probably benign	Het
Mdn1	T	C	4: 32,700,334		probably benign	Het
Mpeg1	T	A	19: 12,461,325	V49D	probably damaging	Het
Nos2	C	T	11: 78,952,803	P859S	probably benign	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Parn	A	T	16: 13,650,674	Y214*	probably null	Het
Pibf1	A	G	14: 99,137,196	E357G	possibly damaging	Het
Prex2	C	T	1: 11,080,092	Q163*	probably null	Het
Prune2	T	A	19: 17,212,317	S294T	probably benign	Het
Slc46a1	A	G	11: 78,470,724	N399D	probably benign	Het
Sstr2	T	C	11: 113,624,894	F213S	probably damaging	Het
Tnxb	A	G	17: 34,695,472	E1967G	possibly damaging	Het
Vmn2r59	A	G	7: 42,011,794	*866Q	probably null	Het

Other mutations in Abca12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Abca12	APN	1	71303541	missense	possibly damaging	0.64
IGL00556:Abca12	APN	1	71353757	missense	probably benign	0.00
IGL00813:Abca12	APN	1	71353762	critical splice acceptor site	probably null
IGL00835:Abca12	APN	1	71302733	missense	probably damaging	1.00
IGL00921:Abca12	APN	1	71285729	missense	probably damaging	1.00
IGL01011:Abca12	APN	1	71263632	missense	probably benign	0.02
IGL01066:Abca12	APN	1	71353730	missense	possibly damaging	0.95
IGL01082:Abca12	APN	1	71314114	missense	probably damaging	1.00
IGL01310:Abca12	APN	1	71284156	missense	probably benign	0.00
IGL01360:Abca12	APN	1	71286489	missense	possibly damaging	0.95
IGL01585:Abca12	APN	1	71319886	missense	probably benign	0.00
IGL01608:Abca12	APN	1	71259442	missense	probably damaging	1.00
IGL01687:Abca12	APN	1	71267610	splice site	probably benign
IGL01700:Abca12	APN	1	71280390	missense	probably benign
IGL01723:Abca12	APN	1	71314168	missense	probably benign	0.01
IGL01804:Abca12	APN	1	71276183	missense	probably benign	0.01
IGL01982:Abca12	APN	1	71346698	missense	probably benign	0.34
IGL02136:Abca12	APN	1	71247142	missense	probably damaging	1.00
IGL02172:Abca12	APN	1	71302658	missense	probably benign	0.09
IGL02222:Abca12	APN	1	71282886	missense	probably benign	0.40
IGL02266:Abca12	APN	1	71268201	nonsense	probably null
IGL02449:Abca12	APN	1	71401749	splice site	probably null
IGL02471:Abca12	APN	1	71258198	missense	probably benign	0.00
IGL02496:Abca12	APN	1	71288553	missense	possibly damaging	0.55
IGL02552:Abca12	APN	1	71294747	missense	probably damaging	0.96
IGL02795:Abca12	APN	1	71288748	missense	probably damaging	1.00
IGL03000:Abca12	APN	1	71321800	missense	probably benign	0.01
IGL03031:Abca12	APN	1	71314024	missense	probably benign	0.00
IGL03131:Abca12	APN	1	71346702	missense	probably benign
IGL03260:Abca12	APN	1	71284099	missense	probably damaging	1.00
IGL03324:Abca12	APN	1	71314008	missense	probably benign
IGL03408:Abca12	APN	1	71264795	missense	probably damaging	1.00
R0016:Abca12	UTSW	1	71294800	missense	probably benign	0.35
R0016:Abca12	UTSW	1	71294800	missense	probably benign	0.35
R0121:Abca12	UTSW	1	71259786	splice site	probably null
R0172:Abca12	UTSW	1	71279402	missense	probably damaging	0.99
R0196:Abca12	UTSW	1	71259813	missense	possibly damaging	0.81
R0400:Abca12	UTSW	1	71259776	splice site	probably benign
R0466:Abca12	UTSW	1	71302663	missense	probably damaging	1.00
R0616:Abca12	UTSW	1	71302671	missense	probably damaging	1.00
R0668:Abca12	UTSW	1	71263614	missense	probably damaging	1.00
R0928:Abca12	UTSW	1	71349174	missense	probably benign	0.06
R1036:Abca12	UTSW	1	71263410	critical splice donor site	probably null
R1086:Abca12	UTSW	1	71295061	splice site	probably benign
R1300:Abca12	UTSW	1	71244808	missense	probably damaging	1.00
R1337:Abca12	UTSW	1	71294819	missense	probably benign	0.03
R1372:Abca12	UTSW	1	71294857	missense	probably damaging	1.00
R1434:Abca12	UTSW	1	71309800	missense	probably benign	0.00
R1580:Abca12	UTSW	1	71265965	missense	possibly damaging	0.65
R1675:Abca12	UTSW	1	71263411	critical splice donor site	probably null
R1773:Abca12	UTSW	1	71288596	missense	probably damaging	1.00
R1829:Abca12	UTSW	1	71295029	missense	probably benign	0.26
R1922:Abca12	UTSW	1	71319924	missense	probably benign	0.10
R1927:Abca12	UTSW	1	71244840	missense	probably damaging	1.00
R2115:Abca12	UTSW	1	71244771	missense	probably benign	0.01
R2146:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2148:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2149:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2150:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2299:Abca12	UTSW	1	71258222	missense	probably damaging	1.00
R2392:Abca12	UTSW	1	71258105	missense	probably damaging	1.00
R2571:Abca12	UTSW	1	71249885	missense	probably benign	0.00
R3077:Abca12	UTSW	1	71267605	missense	probably benign	0.02
R3078:Abca12	UTSW	1	71267605	missense	probably benign	0.02
R3705:Abca12	UTSW	1	71285705	missense	probably damaging	1.00
R3800:Abca12	UTSW	1	71265887	missense	probably damaging	1.00
R3905:Abca12	UTSW	1	71268230	missense	possibly damaging	0.79
R3905:Abca12	UTSW	1	71279457	missense	probably benign	0.02
R3962:Abca12	UTSW	1	71274515	splice site	probably null
R4082:Abca12	UTSW	1	71267463	missense	possibly damaging	0.64
R4131:Abca12	UTSW	1	71319871	critical splice donor site	probably null
R4214:Abca12	UTSW	1	71288697	missense	probably damaging	0.99
R4403:Abca12	UTSW	1	71267436	missense	probably damaging	1.00
R4524:Abca12	UTSW	1	71302917	missense	probably benign	0.19
R4615:Abca12	UTSW	1	71330334	missense	probably benign
R4617:Abca12	UTSW	1	71330334	missense	probably benign
R4714:Abca12	UTSW	1	71321450	missense	probably benign	0.00
R4809:Abca12	UTSW	1	71278856	missense	probably benign	0.10
R4810:Abca12	UTSW	1	71303612	missense	probably benign	0.00
R4825:Abca12	UTSW	1	71302685	missense	possibly damaging	0.70
R4990:Abca12	UTSW	1	71294939	missense	possibly damaging	0.61
R5013:Abca12	UTSW	1	71264767	missense	probably damaging	0.99
R5026:Abca12	UTSW	1	71317224	missense	probably benign	0.04
R5064:Abca12	UTSW	1	71300960	missense	probably damaging	1.00
R5188:Abca12	UTSW	1	71291492	missense	probably benign	0.23
R5234:Abca12	UTSW	1	71263664	missense	probably damaging	0.99
R5267:Abca12	UTSW	1	71335774	splice site	probably benign
R5302:Abca12	UTSW	1	71283952	missense	possibly damaging	0.91
R5441:Abca12	UTSW	1	71295056	missense	probably damaging	1.00
R5451:Abca12	UTSW	1	71294917	missense	possibly damaging	0.94
R5526:Abca12	UTSW	1	71292446	missense	probably benign	0.29
R5529:Abca12	UTSW	1	71264881	missense	probably damaging	1.00
R5615:Abca12	UTSW	1	71307059	missense	probably damaging	1.00
R5649:Abca12	UTSW	1	71291342	missense	probably damaging	1.00
R5800:Abca12	UTSW	1	71321432	missense	possibly damaging	0.78
R5807:Abca12	UTSW	1	71303492	missense	probably damaging	1.00
R5878:Abca12	UTSW	1	71346633	missense	possibly damaging	0.79
R5987:Abca12	UTSW	1	71258098	missense	probably damaging	1.00
R6280:Abca12	UTSW	1	71272460	missense	probably benign	0.04
R6316:Abca12	UTSW	1	71313959	missense	probably benign	0.01
R6337:Abca12	UTSW	1	71295013	missense	probably damaging	1.00
R6383:Abca12	UTSW	1	71247184	missense	probably benign	0.03
R6564:Abca12	UTSW	1	71309850	missense	possibly damaging	0.57
R6582:Abca12	UTSW	1	71258225	missense	probably benign	0.00
R6756:Abca12	UTSW	1	71259353	splice site	probably null
R6876:Abca12	UTSW	1	71263508	missense	probably damaging	0.98
R6999:Abca12	UTSW	1	71317162	nonsense	probably null
R7145:Abca12	UTSW	1	71307053	missense	possibly damaging	0.92
R7272:Abca12	UTSW	1	71248432	missense	probably damaging	0.99
R7285:Abca12	UTSW	1	71349155	nonsense	probably null
R7421:Abca12	UTSW	1	71247136	nonsense	probably null
R7531:Abca12	UTSW	1	71247173	missense	probably damaging	0.99
R7592:Abca12	UTSW	1	71288677	missense	probably benign	0.01
R7687:Abca12	UTSW	1	71258182	missense	probably benign	0.00
R7690:Abca12	UTSW	1	71314154	missense	probably benign	0.00
R7709:Abca12	UTSW	1	71335728	missense	probably benign	0.00
R7736:Abca12	UTSW	1	71319964	missense	probably benign	0.01
R7754:Abca12	UTSW	1	71302887	missense	probably benign
R7761:Abca12	UTSW	1	71330288	missense	probably damaging	1.00
R7808:Abca12	UTSW	1	71274634	splice site	probably null
R7816:Abca12	UTSW	1	71292429	missense	probably benign	0.01
R7821:Abca12	UTSW	1	71259791	missense	probably benign	0.12
R7827:Abca12	UTSW	1	71414678	start gained	probably benign
R7829:Abca12	UTSW	1	71292421	missense	probably benign	0.37
R7863:Abca12	UTSW	1	71293497	missense	probably damaging	0.96
R8053:Abca12	UTSW	1	71349169	nonsense	probably null
R8093:Abca12	UTSW	1	71280393	missense	probably benign	0.00
R8120:Abca12	UTSW	1	71259381	missense	possibly damaging	0.92
R8136:Abca12	UTSW	1	71248397	missense	probably benign	0.15
R8155:Abca12	UTSW	1	71291338	missense	probably damaging	1.00
R8189:Abca12	UTSW	1	71285726	missense	probably damaging	1.00
R8233:Abca12	UTSW	1	71351757	missense	probably benign	0.00
R8249:Abca12	UTSW	1	71321812	missense	probably benign	0.00
R8255:Abca12	UTSW	1	71319899	missense	probably benign	0.13
R8300:Abca12	UTSW	1	71313964	missense	possibly damaging	0.77
R8339:Abca12	UTSW	1	71285672	missense	probably damaging	1.00
R8490:Abca12	UTSW	1	71284097	missense	probably damaging	1.00
R8494:Abca12	UTSW	1	71288662	missense	probably benign	0.02
R8527:Abca12	UTSW	1	71309888	critical splice acceptor site	probably null
R8542:Abca12	UTSW	1	71309888	critical splice acceptor site	probably null
R8692:Abca12	UTSW	1	71288715	missense	probably damaging	0.96
R8723:Abca12	UTSW	1	71321738	missense	probably benign	0.04
R8796:Abca12	UTSW	1	71258089	critical splice donor site	probably benign
R8911:Abca12	UTSW	1	71341531	missense	probably benign	0.07
R8913:Abca12	UTSW	1	71264813	missense	probably damaging	1.00
R8957:Abca12	UTSW	1	71321625	missense	possibly damaging	0.90
R9000:Abca12	UTSW	1	71314036	missense	probably damaging	1.00
R9137:Abca12	UTSW	1	71259366	missense	possibly damaging	0.80
R9228:Abca12	UTSW	1	71293440	missense	probably damaging	1.00
R9237:Abca12	UTSW	1	71279398	missense	probably damaging	0.97
R9299:Abca12	UTSW	1	71319883	missense	possibly damaging	0.48
R9419:Abca12	UTSW	1	71303490	missense	possibly damaging	0.81
X0013:Abca12	UTSW	1	71248433	missense	probably damaging	0.99
X0018:Abca12	UTSW	1	71314510	missense	probably benign
X0063:Abca12	UTSW	1	71349064	missense	probably benign	0.15
X0065:Abca12	UTSW	1	71341461	critical splice donor site	probably null
Z1176:Abca12	UTSW	1	71284070	missense	probably damaging	1.00
Z1177:Abca12	UTSW	1	71276082	missense	possibly damaging	0.94
Z1177:Abca12	UTSW	1	71282811	missense	probably damaging	0.98
Z1177:Abca12	UTSW	1	71292531	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGGATAAGGAACCGCTTGAACCTG -3'
(R):5'- AGTCAGCCAACGGCATTGTCTAAG -3'

Sequencing Primer
(F):5'- GGCGACTTCCTGTGAGTTCC -3'
(R):5'- AGCCTCGTTATCGGTCAAG -3'

Posted On

2014-02-11