Incidental Mutation 'R1356:Lurap1l'
ID156318
Institutional Source Beutler Lab
Gene Symbol Lurap1l
Ensembl Gene ENSMUSG00000048706
Gene Nameleucine rich adaptor protein 1-like
Synonyms1110029A09Rik, WI-13707, D4Bwg0951e
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1356 (G1)
Quality Score177
Status Validated
Chromosome4
Chromosomal Location80910646-80955628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80911530 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 59 (A59G)
Ref Sequence ENSEMBL: ENSMUSP00000062628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055922]
Predicted Effect probably benign
Transcript: ENSMUST00000055922
AA Change: A59G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062628
Gene: ENSMUSG00000048706
AA Change: A59G

DomainStartEndE-ValueType
Pfam:LURAP 70 186 3.3e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Lurap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Lurap1l APN 4 80953857 missense probably damaging 0.99
IGL02244:Lurap1l APN 4 80953629 missense probably damaging 1.00
IGL02943:Lurap1l APN 4 80953635 missense probably damaging 1.00
R4182:Lurap1l UTSW 4 80953858 missense probably benign 0.07
R4183:Lurap1l UTSW 4 80953858 missense probably benign 0.07
R4798:Lurap1l UTSW 4 80911413 missense probably damaging 1.00
R5715:Lurap1l UTSW 4 80953721 missense possibly damaging 0.93
R7033:Lurap1l UTSW 4 80911367 missense probably benign 0.13
R7186:Lurap1l UTSW 4 80911510 missense possibly damaging 0.68
R7225:Lurap1l UTSW 4 80911481 missense probably benign 0.05
R7414:Lurap1l UTSW 4 80953754 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCTCAGAGACATCGAGCTGAAG -3'
(R):5'- CGAGCAAAGTCCTCAGGGTTCAAG -3'

Sequencing Primer
(F):5'- CATCGAGCTGAAGCTGGG -3'
(R):5'- ACTCACCATCTCCTGTCTGA -3'
Posted On2014-02-11