Incidental Mutation 'R1356:Slc46a1'
ID156327
Institutional Source Beutler Lab
Gene Symbol Slc46a1
Ensembl Gene ENSMUSG00000020829
Gene Namesolute carrier family 46, member 1
Synonyms1110002C08Rik, D11Ertd18e, heme carrier protein 1, HCP1, PCFT
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1356 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location78465697-78472059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78470724 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 399 (N399D)
Ref Sequence ENSEMBL: ENSMUSP00000001126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001126] [ENSMUST00000061174] [ENSMUST00000108287] [ENSMUST00000146431]
Predicted Effect probably benign
Transcript: ENSMUST00000001126
AA Change: N399D

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000001126
Gene: ENSMUSG00000020829
AA Change: N399D

DomainStartEndE-ValueType
Pfam:MFS_1 29 443 5.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061174
SMART Domains Protein: ENSMUSP00000051059
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 9.5e-10 SMART
TIR 561 702 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108287
SMART Domains Protein: ENSMUSP00000103922
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 2.15e-8 SMART
TIR 601 742 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180786
Meta Mutation Damage Score 0.1971 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane proton-coupled folate transporter protein that facilitates the movement of folate and antifolate substrates across cell membranes, optimally in acidic pH environments. This protein is also expressed in the brain and choroid plexus where it transports folates into the central nervous system. This protein further functions as a heme transporter in duodenal enterocytes, and potentially in other tissues like liver and kidney. Its localization to the apical membrane or cytoplasm of intestinal cells is modulated by dietary iron levels. Mutations in this gene are associated with autosomal recessive hereditary folate malabsorption disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating and liver levels of N-homocysteine and total homocysteine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Slc46a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0242:Slc46a1 UTSW 11 78468667 missense possibly damaging 0.58
R0242:Slc46a1 UTSW 11 78468667 missense possibly damaging 0.58
R0255:Slc46a1 UTSW 11 78470799 missense probably damaging 1.00
R2088:Slc46a1 UTSW 11 78468645 missense possibly damaging 0.81
R2273:Slc46a1 UTSW 11 78466423 missense probably benign 0.00
R2274:Slc46a1 UTSW 11 78466423 missense probably benign 0.00
R2275:Slc46a1 UTSW 11 78466423 missense probably benign 0.00
R4627:Slc46a1 UTSW 11 78466889 missense probably benign 0.05
R4682:Slc46a1 UTSW 11 78468676 missense possibly damaging 0.85
R5513:Slc46a1 UTSW 11 78466550 missense probably benign 0.38
R5739:Slc46a1 UTSW 11 78467149 missense possibly damaging 0.95
R6033:Slc46a1 UTSW 11 78466007 critical splice donor site probably null
R6033:Slc46a1 UTSW 11 78466007 critical splice donor site probably null
R6351:Slc46a1 UTSW 11 78467159 missense probably benign 0.13
R6807:Slc46a1 UTSW 11 78466964 missense probably damaging 0.96
R6885:Slc46a1 UTSW 11 78466979 missense probably benign 0.04
R7454:Slc46a1 UTSW 11 78466511 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCTCATTGAGCTTTTACTTCAACAC -3'
(R):5'- GGCTTTCTGTGACCACAGTTCTGC -3'

Sequencing Primer
(F):5'- CTTCAACACTGAGATTAGGAGGCTC -3'
(R):5'- agagagagagagccagagag -3'
Posted On2014-02-11