Incidental Mutation 'R1356:Pibf1'
ID156333
Institutional Source Beutler Lab
Gene Symbol Pibf1
Ensembl Gene ENSMUSG00000022064
Gene Nameprogesterone immunomodulatory binding factor 1
Synonyms1700017E21Rik, 4933438D16Rik, 4933439E17Rik, D14Ertd581e, 4930513H15Rik
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1356 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location99099424-99254493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99137196 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 357 (E357G)
Ref Sequence ENSEMBL: ENSMUSP00000022650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022650
AA Change: E357G

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064
AA Change: E357G

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228598
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Pibf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Pibf1 APN 14 99179449 nonsense probably null
IGL01649:Pibf1 APN 14 99187763 missense possibly damaging 0.88
IGL01817:Pibf1 APN 14 99186472 splice site probably benign
IGL02322:Pibf1 APN 14 99210983 missense probably damaging 1.00
IGL03180:Pibf1 APN 14 99133344 missense probably benign 0.14
IGL03269:Pibf1 APN 14 99187735 missense probably damaging 0.98
IGL03354:Pibf1 APN 14 99150738 missense probably benign 0.13
R0053:Pibf1 UTSW 14 99140557 missense probably damaging 1.00
R0969:Pibf1 UTSW 14 99196386 missense probably benign 0.02
R0981:Pibf1 UTSW 14 99150743 critical splice donor site probably null
R1110:Pibf1 UTSW 14 99112973 missense probably damaging 0.99
R1205:Pibf1 UTSW 14 99101203 missense probably damaging 1.00
R1432:Pibf1 UTSW 14 99112989 missense probably benign 0.14
R1622:Pibf1 UTSW 14 99186481 missense probably benign 0.34
R1912:Pibf1 UTSW 14 99187809 critical splice donor site probably null
R2393:Pibf1 UTSW 14 99242932 missense probably benign 0.07
R3847:Pibf1 UTSW 14 99137121 missense possibly damaging 0.57
R4028:Pibf1 UTSW 14 99179341 missense probably damaging 0.99
R4673:Pibf1 UTSW 14 99133351 missense possibly damaging 0.93
R4857:Pibf1 UTSW 14 99186501 nonsense probably null
R4874:Pibf1 UTSW 14 99140556 missense probably damaging 1.00
R4992:Pibf1 UTSW 14 99150667 missense probably damaging 0.98
R5330:Pibf1 UTSW 14 99140646 missense probably damaging 1.00
R5543:Pibf1 UTSW 14 99112992 missense probably benign 0.38
R5582:Pibf1 UTSW 14 99137130 missense possibly damaging 0.64
R5922:Pibf1 UTSW 14 99137088 missense probably benign
R6088:Pibf1 UTSW 14 99179358 missense probably benign 0.01
R6169:Pibf1 UTSW 14 99113007 missense probably null 0.96
R6226:Pibf1 UTSW 14 99101119 missense probably damaging 1.00
R6232:Pibf1 UTSW 14 99186578 missense probably benign 0.16
R6339:Pibf1 UTSW 14 99107398 missense probably damaging 0.97
R6450:Pibf1 UTSW 14 99137210 missense probably damaging 1.00
R6828:Pibf1 UTSW 14 99186551 missense probably benign 0.31
R7185:Pibf1 UTSW 14 99107316 missense possibly damaging 0.80
R7201:Pibf1 UTSW 14 99196408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTGGTTGGGTACAATGCACATAG -3'
(R):5'- GTTGTTACTGGAAGACCGCAGTATCTC -3'

Sequencing Primer
(F):5'- GAGAAGTAGCACTCACTCTGAACTG -3'
(R):5'- GAAGACCGCAGTATCTCTAAGAAATC -3'
Posted On2014-02-11