Incidental Mutation 'R1356:Cd274'
ID 156341
Institutional Source Beutler Lab
Gene Symbol Cd274
Ensembl Gene ENSMUSG00000016496
Gene Name CD274 antigen
Synonyms Pdcd1lg1, PD-L1, B7-H1
MMRRC Submission 039421-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1356 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 29344855-29365495 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 29350970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 22 (T22K)
Ref Sequence ENSEMBL: ENSMUSP00000016640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016640]
AlphaFold Q9EP73
Predicted Effect possibly damaging
Transcript: ENSMUST00000016640
AA Change: T22K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016640
Gene: ENSMUSG00000016496
AA Change: T22K

DomainStartEndE-ValueType
IG 24 131 1.5e-7 SMART
IG_like 138 226 4.78e1 SMART
Meta Mutation Damage Score 0.5169 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered susceptibility to experimental autoimmune encephalomyelitis, induced arthritis, nerve injury, autoimmune diabetes, bacterial infection, viral infection, and parasitic infection due to abnormal T cellmorphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,342,112 (GRCm39) probably benign Het
Adam18 A G 8: 25,158,611 (GRCm39) probably benign Het
Cfap45 G A 1: 172,355,430 (GRCm39) R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,343,055 (GRCm39) probably benign Het
E2f8 A G 7: 48,530,018 (GRCm39) probably benign Het
Ercc4 A G 16: 12,943,146 (GRCm39) H255R probably damaging Het
Fam227b C T 2: 125,960,928 (GRCm39) D234N probably damaging Het
Foxp1 A T 6: 98,993,637 (GRCm39) probably benign Het
Fsip2 T A 2: 82,820,089 (GRCm39) V5274D probably benign Het
Gm21718 A G 14: 51,554,104 (GRCm39) noncoding transcript Het
Gpr85 G A 6: 13,836,146 (GRCm39) P253S probably benign Het
Grm7 A T 6: 111,335,985 (GRCm39) I799F probably damaging Het
Inpp1 A G 1: 52,836,215 (GRCm39) F84L possibly damaging Het
Kprp T A 3: 92,732,909 (GRCm39) E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,079,640 (GRCm39) probably benign Het
Lama3 G A 18: 12,633,634 (GRCm39) probably benign Het
Lurap1l C G 4: 80,829,767 (GRCm39) A59G probably benign Het
Macc1 A T 12: 119,410,290 (GRCm39) T353S probably benign Het
Mctp2 A G 7: 71,814,471 (GRCm39) probably benign Het
Mdn1 T C 4: 32,700,334 (GRCm39) probably benign Het
Mpeg1 T A 19: 12,438,689 (GRCm39) V49D probably damaging Het
Nos2 C T 11: 78,843,629 (GRCm39) P859S probably benign Het
Or8g18 G C 9: 39,149,547 (GRCm39) P58A probably benign Het
Parn A T 16: 13,468,538 (GRCm39) Y214* probably null Het
Pibf1 A G 14: 99,374,632 (GRCm39) E357G possibly damaging Het
Prex2 C T 1: 11,150,316 (GRCm39) Q163* probably null Het
Prune2 T A 19: 17,189,681 (GRCm39) S294T probably benign Het
Slc46a1 A G 11: 78,361,550 (GRCm39) N399D probably benign Het
Sstr2 T C 11: 113,515,720 (GRCm39) F213S probably damaging Het
Tnxb A G 17: 34,914,446 (GRCm39) E1967G possibly damaging Het
Vmn2r59 A G 7: 41,661,218 (GRCm39) *866Q probably null Het
Other mutations in Cd274
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Cd274 APN 19 29,362,810 (GRCm39) makesense probably null
IGL02232:Cd274 APN 19 29,359,938 (GRCm39) missense probably damaging 0.99
IGL03304:Cd274 APN 19 29,361,502 (GRCm39) missense probably damaging 0.99
R1233:Cd274 UTSW 19 29,351,301 (GRCm39) critical splice donor site probably null
R1464:Cd274 UTSW 19 29,359,992 (GRCm39) splice site probably benign
R1853:Cd274 UTSW 19 29,357,882 (GRCm39) missense probably damaging 1.00
R4280:Cd274 UTSW 19 29,357,871 (GRCm39) missense probably benign
R4283:Cd274 UTSW 19 29,357,871 (GRCm39) missense probably benign
R4553:Cd274 UTSW 19 29,357,848 (GRCm39) missense probably benign 0.43
R5063:Cd274 UTSW 19 29,361,543 (GRCm39) missense probably damaging 0.99
R5122:Cd274 UTSW 19 29,357,965 (GRCm39) missense possibly damaging 0.57
R5187:Cd274 UTSW 19 29,359,936 (GRCm39) missense probably benign 0.01
R5736:Cd274 UTSW 19 29,359,940 (GRCm39) missense probably benign 0.02
R6400:Cd274 UTSW 19 29,362,808 (GRCm39) missense probably damaging 1.00
R8114:Cd274 UTSW 19 29,361,528 (GRCm39) missense probably damaging 1.00
R8247:Cd274 UTSW 19 29,362,795 (GRCm39) nonsense probably null
R9099:Cd274 UTSW 19 29,357,771 (GRCm39) nonsense probably null
R9525:Cd274 UTSW 19 29,359,879 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TACTGAACATTCCCAGGGAGGTGG -3'
(R):5'- AAAAGCTGGTCCTTTGGCAGCG -3'

Sequencing Primer
(F):5'- GGTTCCTTTTAAACAAGACTGGG -3'
(R):5'- CCCCCTGAAGTTGCTGTG -3'
Posted On 2014-02-11