Incidental Mutation 'R1363:Ifi204'
ID156347
Institutional Source Beutler Lab
Gene Symbol Ifi204
Ensembl Gene ENSMUSG00000073489
Gene Nameinterferon activated gene 204
Synonymsp204
MMRRC Submission 039428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1363 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173747293-173766943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173749296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 580 (V580I)
Ref Sequence ENSEMBL: ENSMUSP00000106845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111214]
Predicted Effect probably benign
Transcript: ENSMUST00000111214
AA Change: V580I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106845
Gene: ENSMUSG00000073489
AA Change: V580I

DomainStartEndE-ValueType
PYRIN 6 84 8.33e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 6.2e-78 PFAM
Pfam:HIN 429 595 9.8e-78 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88b T A 19: 6,850,371 Y921F possibly damaging Het
Cct7 G T 6: 85,466,035 D265Y probably damaging Het
Cdc14a CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG 3: 116,293,860 probably benign Het
Csf1r A G 18: 61,124,845 M629V possibly damaging Het
Dlk1 G T 12: 109,455,504 G48V probably damaging Het
Fancc T C 13: 63,361,598 Y60C probably damaging Het
Irs1 A G 1: 82,287,288 V1069A probably benign Het
Plxna2 C T 1: 194,804,939 Q1601* probably null Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptpn14 C A 1: 189,798,628 F97L probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf6 A T 5: 146,211,559 F216L probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scyl3 A G 1: 163,950,690 I466V probably benign Het
Slc7a11 T C 3: 50,424,051 Y246C probably damaging Het
Stk33 A T 7: 109,279,821 S440R probably benign Het
Ttbk2 T C 2: 120,806,908 probably null Het
Vmn2r105 T A 17: 20,208,670 T715S probably benign Het
Other mutations in Ifi204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Ifi204 APN 1 173759631 splice site probably benign
IGL01922:Ifi204 APN 1 173761722 missense possibly damaging 0.51
IGL02296:Ifi204 APN 1 173749314 missense possibly damaging 0.93
IGL02419:Ifi204 APN 1 173749380 missense possibly damaging 0.71
IGL02505:Ifi204 APN 1 173755654 missense probably benign 0.04
R0938:Ifi204 UTSW 1 173751745 missense possibly damaging 0.85
R1834:Ifi204 UTSW 1 173747606 missense unknown
R2031:Ifi204 UTSW 1 173752777 missense probably damaging 1.00
R2254:Ifi204 UTSW 1 173761730 missense possibly damaging 0.95
R2379:Ifi204 UTSW 1 173755993 nonsense probably null
R2408:Ifi204 UTSW 1 173755632 missense possibly damaging 0.80
R3011:Ifi204 UTSW 1 173751651 missense probably benign 0.01
R3617:Ifi204 UTSW 1 173755717 missense possibly damaging 0.51
R3894:Ifi204 UTSW 1 173749208 missense possibly damaging 0.86
R3916:Ifi204 UTSW 1 173755775 missense possibly damaging 0.95
R4656:Ifi204 UTSW 1 173760361 intron probably benign
R4657:Ifi204 UTSW 1 173760361 intron probably benign
R4694:Ifi204 UTSW 1 173749259 missense probably damaging 0.99
R4703:Ifi204 UTSW 1 173760361 intron probably benign
R4704:Ifi204 UTSW 1 173760361 intron probably benign
R4894:Ifi204 UTSW 1 173760242 missense probably damaging 0.98
R4947:Ifi204 UTSW 1 173755750 missense probably damaging 0.98
R5023:Ifi204 UTSW 1 173751740 missense possibly damaging 0.93
R5036:Ifi204 UTSW 1 173752745 missense possibly damaging 0.79
R5119:Ifi204 UTSW 1 173755668 missense probably damaging 1.00
R5194:Ifi204 UTSW 1 173749344 missense possibly damaging 0.86
R5762:Ifi204 UTSW 1 173752759 missense probably damaging 0.98
R6063:Ifi204 UTSW 1 173751657 missense probably benign 0.03
R6808:Ifi204 UTSW 1 173761703 missense probably benign 0.27
R7311:Ifi204 UTSW 1 173759568 missense probably benign 0.26
R7338:Ifi204 UTSW 1 173760137 missense possibly damaging 0.67
R7430:Ifi204 UTSW 1 173755681 missense probably benign 0.43
R7528:Ifi204 UTSW 1 173751840 missense probably benign 0.06
Z1176:Ifi204 UTSW 1 173751628 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTCTGCAACAGAAAGTATTGGCAT -3'
(R):5'- AGTTCTCATAGATGTGACAACCTTTGGC -3'

Sequencing Primer
(F):5'- acaaacaaacaaacaaacaacaaac -3'
(R):5'- GATGTGACAACCTTTGGCATATTTC -3'
Posted On2014-02-11