Incidental Mutation 'R1342:Cdc73'
ID 156384
Institutional Source Beutler Lab
Gene Symbol Cdc73
Ensembl Gene ENSMUSG00000026361
Gene Name cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms Hrpt2, 8430414L16Rik, C130030P16Rik
MMRRC Submission 039407-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1342 (G1)
Quality Score 177
Status Validated
Chromosome 1
Chromosomal Location 143598800-143702893 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 143702492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337] [ENSMUST00000159794]
AlphaFold Q8JZM7
Predicted Effect probably null
Transcript: ENSMUST00000018337
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159794
SMART Domains Protein: ENSMUSP00000139872
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
low complexity region 36 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212510
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality around hatching or implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Cdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cdc73 APN 1 143671332 missense probably benign 0.10
IGL01598:Cdc73 APN 1 143699279 missense probably damaging 1.00
R0648:Cdc73 UTSW 1 143695462 missense probably benign 0.00
R1299:Cdc73 UTSW 1 143699281 missense probably benign 0.00
R1411:Cdc73 UTSW 1 143609514 splice site probably benign
R1837:Cdc73 UTSW 1 143667657 missense possibly damaging 0.46
R2208:Cdc73 UTSW 1 143609382 missense probably damaging 1.00
R3721:Cdc73 UTSW 1 143695453 missense possibly damaging 0.77
R3797:Cdc73 UTSW 1 143677723 missense probably benign 0.22
R4088:Cdc73 UTSW 1 143608514 utr 3 prime probably benign
R4603:Cdc73 UTSW 1 143677857 critical splice acceptor site probably null
R4782:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R4799:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R5512:Cdc73 UTSW 1 143702616 missense probably damaging 1.00
R5801:Cdc73 UTSW 1 143608543 missense probably benign 0.01
R6006:Cdc73 UTSW 1 143617439 missense probably damaging 1.00
R6258:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6260:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6744:Cdc73 UTSW 1 143702149 intron probably benign
R8513:Cdc73 UTSW 1 143617391 nonsense probably null
R9030:Cdc73 UTSW 1 143609496 missense probably damaging 1.00
R9431:Cdc73 UTSW 1 143670002 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTCGGCTTCTCCAACACAGAG -3'
(R):5'- GGCCTTGCCTTATATAGCGCGG -3'

Sequencing Primer
(F):5'- GACTTGACCGCTCTAGAATCCG -3'
(R):5'- gaagagggcgaggcgac -3'
Posted On 2014-02-11