Incidental Mutation 'R1342:Slc5a12'
ID156385
Institutional Source Beutler Lab
Gene Symbol Slc5a12
Ensembl Gene ENSMUSG00000041644
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 12
SynonymsSMCT2
MMRRC Submission 039407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1342 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location110597298-110647779 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 110617090 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045972] [ENSMUST00000111026]
Predicted Effect probably null
Transcript: ENSMUST00000045972
SMART Domains Protein: ENSMUSP00000047340
Gene: ENSMUSG00000041644

DomainStartEndE-ValueType
Pfam:SSF 41 449 6.5e-43 PFAM
transmembrane domain 507 529 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111026
SMART Domains Protein: ENSMUSP00000106655
Gene: ENSMUSG00000041644

DomainStartEndE-ValueType
Pfam:SSF 41 445 6.2e-48 PFAM
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146664
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Normal blood lactate is maintained at about 1.5 mM, and little filtered lactate is excreted in urine. Reabsorption of lactate is mediated by the low-affinity Na(+)-coupled lactate transporter SLC5A12 in the initial part of the proximal tubule and by the high-affinity Na(+)-coupled lactate transporter SLC5A8 (MIM 608044) in the distal proximal tubule (Gopal et al., 2007 [PubMed 17692818]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Slc5a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc5a12 APN 2 110597822 missense probably damaging 1.00
IGL01337:Slc5a12 APN 2 110620373 nonsense probably null
IGL01830:Slc5a12 APN 2 110597806 missense probably damaging 1.00
IGL02456:Slc5a12 APN 2 110616834 splice site probably benign
IGL02619:Slc5a12 APN 2 110640856 missense probably benign 0.00
IGL02832:Slc5a12 APN 2 110640815 missense probably benign
IGL02890:Slc5a12 APN 2 110624133 splice site probably benign
IGL03058:Slc5a12 APN 2 110640792 missense probably benign 0.23
R0607:Slc5a12 UTSW 2 110632743 missense probably benign 0.30
R1532:Slc5a12 UTSW 2 110610138 missense possibly damaging 0.64
R1992:Slc5a12 UTSW 2 110621744 missense probably benign 0.04
R2354:Slc5a12 UTSW 2 110609432 missense probably damaging 0.97
R3830:Slc5a12 UTSW 2 110632736 nonsense probably null
R4728:Slc5a12 UTSW 2 110644424 nonsense probably null
R4822:Slc5a12 UTSW 2 110621740 missense possibly damaging 0.90
R4937:Slc5a12 UTSW 2 110620408 missense probably damaging 1.00
R5860:Slc5a12 UTSW 2 110597624 missense probably benign 0.30
R6075:Slc5a12 UTSW 2 110616747 missense probably damaging 1.00
R6168:Slc5a12 UTSW 2 110616744 missense probably damaging 1.00
R6853:Slc5a12 UTSW 2 110624194 missense probably benign 0.37
R6870:Slc5a12 UTSW 2 110641810 missense probably damaging 0.99
R7014:Slc5a12 UTSW 2 110644364 missense probably benign 0.00
R7135:Slc5a12 UTSW 2 110616714 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCCGGCTACACATTGTTGAGTACG -3'
(R):5'- TGAAGCAGGCATCCATCTTCCTCC -3'

Sequencing Primer
(F):5'- GACGGCACACTTTTTGGACA -3'
(R):5'- CCCTCAACACATACTTTCATacac -3'
Posted On2014-02-11