Incidental Mutation 'R1342:Mrvi1'
ID156401
Institutional Source Beutler Lab
Gene Symbol Mrvi1
Ensembl Gene ENSMUSG00000005611
Gene NameMRV integration site 1
SynonymsRis1
MMRRC Submission 039407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1342 (G1)
Quality Score191
Status Validated
Chromosome7
Chromosomal Location110868266-110982461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110888045 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 699 (M699L)
Ref Sequence ENSEMBL: ENSMUSP00000114578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005751] [ENSMUST00000125758] [ENSMUST00000127935]
Predicted Effect probably benign
Transcript: ENSMUST00000005751
AA Change: M634L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005751
Gene: ENSMUSG00000005611
AA Change: M634L

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
low complexity region 138 160 N/A INTRINSIC
Pfam:MRVI1 265 856 1.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125758
AA Change: M699L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114578
Gene: ENSMUSG00000005611
AA Change: M699L

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
Pfam:MRVI1 336 921 1.5e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127935
AA Change: M493L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000120045
Gene: ENSMUSG00000005611
AA Change: M493L

DomainStartEndE-ValueType
Pfam:MRVI1 124 715 7.9e-228 PFAM
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene is a putative tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein participates in signaling by nitric oxide (NO) to inhibit intracellular calcium release and platelet aggregation in cardiovascular tissue. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show lower blood pressure, a slightly reduced heart rate, and failure of cGMP-mediated relaxation of receptor-triggered smooth muscle contraction; 50% of mice die prematurely with an enlarged stomach, a dilated cecum, pyloric stenosis and impaired GI motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Mrvi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Mrvi1 APN 7 110945967 missense possibly damaging 0.64
IGL01384:Mrvi1 APN 7 110926501 missense possibly damaging 0.89
IGL01474:Mrvi1 APN 7 110871433 missense possibly damaging 0.65
IGL02081:Mrvi1 APN 7 110924074 critical splice acceptor site probably null
IGL02193:Mrvi1 APN 7 110898955 missense probably damaging 1.00
IGL02537:Mrvi1 APN 7 110871473 nonsense probably null
IGL03084:Mrvi1 APN 7 110885829 splice site probably benign
IGL03264:Mrvi1 APN 7 110926346 missense probably benign 0.00
hurricane UTSW 7 110923963 missense probably benign 0.09
R0346:Mrvi1 UTSW 7 110898976 missense probably damaging 1.00
R0401:Mrvi1 UTSW 7 110876897 missense probably benign 0.09
R0731:Mrvi1 UTSW 7 110876900 missense probably benign 0.00
R1168:Mrvi1 UTSW 7 110895931 missense probably damaging 1.00
R1887:Mrvi1 UTSW 7 110924533 critical splice donor site probably null
R2183:Mrvi1 UTSW 7 110898982 missense probably damaging 1.00
R3417:Mrvi1 UTSW 7 110876954 missense possibly damaging 0.90
R3736:Mrvi1 UTSW 7 110923963 missense probably benign 0.09
R4063:Mrvi1 UTSW 7 110923777 missense probably benign 0.38
R4436:Mrvi1 UTSW 7 110876917 missense probably damaging 1.00
R4523:Mrvi1 UTSW 7 110923841 missense probably benign 0.02
R4948:Mrvi1 UTSW 7 110888029 missense probably damaging 1.00
R5070:Mrvi1 UTSW 7 110925312 missense probably benign
R5085:Mrvi1 UTSW 7 110871493 missense probably damaging 1.00
R5605:Mrvi1 UTSW 7 110946002 missense possibly damaging 0.85
R6194:Mrvi1 UTSW 7 110899694 missense probably damaging 1.00
R6218:Mrvi1 UTSW 7 110876905 missense probably benign 0.00
R6273:Mrvi1 UTSW 7 110871583 missense probably benign 0.01
R6608:Mrvi1 UTSW 7 110888551 missense probably damaging 1.00
R6754:Mrvi1 UTSW 7 110929512 missense probably damaging 1.00
R6835:Mrvi1 UTSW 7 110921334 missense probably damaging 1.00
R7064:Mrvi1 UTSW 7 110895854 missense probably damaging 1.00
R7304:Mrvi1 UTSW 7 110899724 missense possibly damaging 0.77
R7412:Mrvi1 UTSW 7 110923756 missense probably benign 0.06
R7420:Mrvi1 UTSW 7 110871473 nonsense probably null
X0065:Mrvi1 UTSW 7 110924044 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAATGTTCTGCCCCTGCTGACC -3'
(R):5'- TCCAATGCTCCCAGAAGAAACGTG -3'

Sequencing Primer
(F):5'- GACCCTGTCCCTATCTACGAG -3'
(R):5'- CGTGTCAGAAATCTTCATGGTCAC -3'
Posted On2014-02-11