Incidental Mutation 'R1342:Palld'
ID156403
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Namepalladin, cytoskeletal associated protein
Synonyms2410003B16Rik
MMRRC Submission 039407-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1342 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61511433-61902690 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 61522882 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
Predicted Effect probably null
Transcript: ENSMUST00000034057
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121200
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121493
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121785
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135439
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136825
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
C6 T C 15: 4,739,749 probably benign Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0745:Palld UTSW 8 61877703 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3815:Palld UTSW 8 61549837 intron probably benign
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5427:Palld UTSW 8 61550072 missense probably benign 0.01
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
R7386:Palld UTSW 8 61532052 missense unknown
R7407:Palld UTSW 8 61515941 nonsense probably null
R7723:Palld UTSW 8 61711458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGCAGGGCAGATTCATCACAC -3'
(R):5'- ACTCAGACCGGGACTTATGTCTCC -3'

Sequencing Primer
(F):5'- GGGCAGATTCATCACACTTAACTG -3'
(R):5'- GGACTTATGTCTCCTGGAAATAGC -3'
Posted On2014-02-11