Incidental Mutation 'R1342:C6'
ID156414
Institutional Source Beutler Lab
Gene Symbol C6
Ensembl Gene ENSMUSG00000022181
Gene Namecomplement component 6
Synonyms
MMRRC Submission 039407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1342 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4727175-4814967 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 4739749 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022788] [ENSMUST00000161997] [ENSMUST00000162350] [ENSMUST00000162585]
Predicted Effect probably benign
Transcript: ENSMUST00000022788
SMART Domains Protein: ENSMUSP00000022788
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161997
SMART Domains Protein: ENSMUSP00000125358
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
Blast:TSP1 197 223 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162350
SMART Domains Protein: ENSMUSP00000125693
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Blast:FIMAC 859 931 1e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162585
SMART Domains Protein: ENSMUSP00000124417
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased susceptibility to ischemia reperfusion-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a G T 7: 58,816,146 probably benign Het
B3gnt9 T C 8: 105,254,324 E144G probably null Het
Bcl9 G T 3: 97,205,726 Q1138K possibly damaging Het
Ccl4 A G 11: 83,663,576 probably benign Het
Cdc73 A G 1: 143,702,492 probably null Het
Cemip A T 7: 83,944,075 L1140* probably null Het
Chd4 C A 6: 125,097,188 P8Q probably benign Het
Col27a1 G A 4: 63,257,114 probably null Het
Col9a1 G A 1: 24,223,620 probably null Het
Colgalt1 C T 8: 71,618,160 T232I probably damaging Het
Dnah8 A G 17: 30,721,000 D1640G probably damaging Het
Dot1l T G 10: 80,786,025 C504G probably benign Het
Gm9892 T C 8: 52,196,423 T212A probably benign Het
Hjurp G A 1: 88,277,368 probably benign Het
Ifnar2 A G 16: 91,403,921 D350G possibly damaging Het
Ift172 T C 5: 31,261,866 I1144V probably benign Het
Ipo7 A T 7: 110,029,804 N94Y possibly damaging Het
Mapkbp1 C A 2: 119,998,534 A57D possibly damaging Het
Mmd T A 11: 90,276,850 I235N probably benign Het
Mrvi1 T A 7: 110,888,045 M699L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Palld A G 8: 61,522,882 probably null Het
Parp4 G A 14: 56,590,397 E202K probably damaging Het
Pclo C A 5: 14,682,177 probably benign Het
Pde8a T C 7: 81,302,294 probably null Het
Pdgfrb T A 18: 61,065,880 L370* probably null Het
Phf2 A T 13: 48,804,477 S1020R unknown Het
Pik3r4 T A 9: 105,650,901 probably null Het
Plxnb1 C A 9: 109,100,652 P192Q possibly damaging Het
Ppil3 A T 1: 58,440,878 I46N probably damaging Het
Prr14l A C 5: 32,830,260 C630W probably damaging Het
Rfx5 A G 3: 94,958,412 I341V probably benign Het
Ryr3 T C 2: 112,750,803 K2895E probably damaging Het
Slc5a12 T C 2: 110,617,090 probably null Het
Slc8a3 T C 12: 81,316,016 T10A probably damaging Het
Ss18 A G 18: 14,636,538 Y321H unknown Het
Sspo A G 6: 48,461,635 N1546D probably benign Het
Thbs4 G A 13: 92,752,417 L923F probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in C6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:C6 APN 15 4759967 missense possibly damaging 0.53
IGL00918:C6 APN 15 4735257 missense possibly damaging 0.90
IGL01615:C6 APN 15 4781896 missense probably benign 0.00
IGL01637:C6 APN 15 4759917 missense possibly damaging 0.69
IGL01662:C6 APN 15 4792754 missense probably damaging 1.00
IGL02293:C6 APN 15 4755303 missense probably benign 0.01
IGL02431:C6 APN 15 4759861 nonsense probably null
IGL02568:C6 APN 15 4791164 nonsense probably null
IGL02688:C6 APN 15 4798320 missense probably benign 0.00
IGL02737:C6 APN 15 4796914 missense probably benign 0.30
R0195:C6 UTSW 15 4763471 missense probably benign 0.01
R0334:C6 UTSW 15 4755367 missense probably benign 0.24
R0879:C6 UTSW 15 4763336 splice site probably benign
R0940:C6 UTSW 15 4735235 missense probably benign 0.12
R1649:C6 UTSW 15 4735257 missense possibly damaging 0.90
R1709:C6 UTSW 15 4790970 missense probably benign 0.34
R1967:C6 UTSW 15 4759820 missense probably damaging 0.99
R2068:C6 UTSW 15 4791070 missense probably damaging 1.00
R3056:C6 UTSW 15 4739873 missense probably damaging 0.99
R3791:C6 UTSW 15 4735235 missense probably benign 0.00
R3821:C6 UTSW 15 4789584 missense probably benign 0.23
R3895:C6 UTSW 15 4808470 missense probably benign 0.00
R4178:C6 UTSW 15 4735139 missense probably benign 0.02
R4440:C6 UTSW 15 4735251 missense possibly damaging 0.90
R4598:C6 UTSW 15 4763370 missense possibly damaging 0.55
R4632:C6 UTSW 15 4759868 missense probably benign 0.01
R4756:C6 UTSW 15 4781912 missense probably benign
R4879:C6 UTSW 15 4803647 unclassified probably null
R5452:C6 UTSW 15 4814829 missense possibly damaging 0.51
R5538:C6 UTSW 15 4814829 missense possibly damaging 0.84
R5547:C6 UTSW 15 4808488 missense probably benign 0.00
R5790:C6 UTSW 15 4763486 missense probably damaging 1.00
R5862:C6 UTSW 15 4735263 missense possibly damaging 0.66
R5946:C6 UTSW 15 4808514 missense possibly damaging 0.96
R6049:C6 UTSW 15 4735172 missense probably damaging 1.00
R6247:C6 UTSW 15 4763541 missense probably damaging 1.00
R6438:C6 UTSW 15 4796983 missense possibly damaging 0.94
R6873:C6 UTSW 15 4790979 missense probably benign 0.03
R7052:C6 UTSW 15 4733695 missense probably damaging 0.97
R7302:C6 UTSW 15 4796950 missense probably damaging 1.00
R7361:C6 UTSW 15 4796922 nonsense probably null
R7481:C6 UTSW 15 4814875 missense
R7492:C6 UTSW 15 4731714 missense probably benign 0.00
R7498:C6 UTSW 15 4763364 missense probably damaging 1.00
R7569:C6 UTSW 15 4789581 missense probably benign 0.01
R7653:C6 UTSW 15 4814762 missense
R7666:C6 UTSW 15 4789505 missense probably damaging 0.99
R7843:C6 UTSW 15 4808404 missense
R8073:C6 UTSW 15 4735193 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CTGGCTTCTTCCACGCAACATAAAC -3'
(R):5'- GTTACATACCCAGTGCCCATCAGC -3'

Sequencing Primer
(F):5'- CTTCCACGCAACATAAACTTTTAG -3'
(R):5'- GCTGCACACTAGGGATGG -3'
Posted On2014-02-11