Incidental Mutation 'R1343:Vmn2r53'
ID 156431
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 039408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R1343 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12584774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 458 (P458L)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably benign
Transcript: ENSMUST00000170412
AA Change: P458L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: P458L

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 T C 5: 110,237,966 V361A probably damaging Het
Art1 A G 7: 102,106,953 Y117C probably damaging Het
Cecr2 T C 6: 120,754,711 Y215H probably damaging Het
Col6a3 T C 1: 90,768,347 E2666G unknown Het
Cps1 T A 1: 67,209,609 V1165E probably damaging Het
Gm11397 G A 13: 33,404,485 C351Y possibly damaging Het
Gpr65 A T 12: 98,275,629 K180N probably benign Het
Gsto2 A T 19: 47,884,707 probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Kif19a A G 11: 114,785,827 D494G probably benign Het
Lnx1 T C 5: 74,597,379 R695G probably damaging Het
Lonp1 A G 17: 56,620,272 L327P probably damaging Het
Nat8 T C 6: 85,830,621 T177A probably damaging Het
Nek1 T A 8: 61,028,675 M208K probably damaging Het
Obsl1 G T 1: 75,492,579 H1239Q probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Prmt3 C T 7: 49,818,108 S354L probably benign Het
Ralgapa1 T A 12: 55,707,978 H1176L probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Strc T C 2: 121,365,115 S1618G probably benign Het
Syne2 T C 12: 76,033,643 S4784P probably damaging Het
Usp14 T C 18: 10,016,623 T73A probably benign Het
Zfp292 T C 4: 34,805,238 D2602G probably damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12581985 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCTACCTAAGTCCACAGGAAAGC -3'
(R):5'- GGAGTCCACTGAGGAATTGATCCATTG -3'

Sequencing Primer
(F):5'- tcctgtgaaactctaagtaagcc -3'
(R):5'- GATCCATTGATTAGGACAGATGC -3'
Posted On 2014-02-11