Incidental Mutation 'R1343:Gm11397'
ID156441
Institutional Source Beutler Lab
Gene Symbol Gm11397
Ensembl Gene ENSMUSG00000071452
Gene Namepredicted gene 11397
Synonyms
MMRRC Submission 039408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R1343 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33395761-33405285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33404485 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 351 (C351Y)
Ref Sequence ENSEMBL: ENSMUSP00000049819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050276]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050276
AA Change: C351Y

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049819
Gene: ENSMUSG00000071452
AA Change: C351Y

DomainStartEndE-ValueType
SERPIN 13 377 1.3e-164 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 T C 5: 110,237,966 V361A probably damaging Het
Art1 A G 7: 102,106,953 Y117C probably damaging Het
Cecr2 T C 6: 120,754,711 Y215H probably damaging Het
Col6a3 T C 1: 90,768,347 E2666G unknown Het
Cps1 T A 1: 67,209,609 V1165E probably damaging Het
Gpr65 A T 12: 98,275,629 K180N probably benign Het
Gsto2 A T 19: 47,884,707 probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Kif19a A G 11: 114,785,827 D494G probably benign Het
Lnx1 T C 5: 74,597,379 R695G probably damaging Het
Lonp1 A G 17: 56,620,272 L327P probably damaging Het
Nat8 T C 6: 85,830,621 T177A probably damaging Het
Nek1 T A 8: 61,028,675 M208K probably damaging Het
Obsl1 G T 1: 75,492,579 H1239Q probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Prmt3 C T 7: 49,818,108 S354L probably benign Het
Ralgapa1 T A 12: 55,707,978 H1176L probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Strc T C 2: 121,365,115 S1618G probably benign Het
Syne2 T C 12: 76,033,643 S4784P probably damaging Het
Usp14 T C 18: 10,016,623 T73A probably benign Het
Vmn2r53 G A 7: 12,584,774 P458L probably benign Het
Zfp292 T C 4: 34,805,238 D2602G probably damaging Het
Other mutations in Gm11397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Gm11397 APN 13 33404199 missense probably damaging 0.99
IGL02662:Gm11397 APN 13 33404530 missense possibly damaging 0.51
R0017:Gm11397 UTSW 13 33404511 missense probably damaging 0.99
R1757:Gm11397 UTSW 13 33399353 missense probably benign 0.00
R1886:Gm11397 UTSW 13 33404220 missense possibly damaging 0.56
R5559:Gm11397 UTSW 13 33404318 missense probably benign
R5681:Gm11397 UTSW 13 33395829 missense probably damaging 0.98
R6189:Gm11397 UTSW 13 33404444 missense probably benign
R7585:Gm11397 UTSW 13 33404316 missense probably benign 0.43
R7746:Gm11397 UTSW 13 33397858 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTTCGATGGAAGCAAGGCTG -3'
(R):5'- GTCATCTGACCTGGCAAAGGACAC -3'

Sequencing Primer
(F):5'- GGCTGACTTATCAGGAATGTCTAC -3'
(R):5'- ACGGTGAAAGTTCCTTCATCTTG -3'
Posted On2014-02-11