Incidental Mutation 'R1343:Gsto2'
ID156445
Institutional Source Beutler Lab
Gene Symbol Gsto2
Ensembl Gene ENSMUSG00000025069
Gene Nameglutathione S-transferase omega 2
Synonyms4930425C18Rik, 1700020F09Rik
MMRRC Submission 039408-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1343 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47865545-47886324 bp(+) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) A to T at 47884707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056159] [ENSMUST00000120645] [ENSMUST00000135016]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably damaging
Transcript: ENSMUST00000056159
AA Change: I174F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052592
Gene: ENSMUSG00000025069
AA Change: I174F

DomainStartEndE-ValueType
Pfam:GST_N 23 95 1.7e-9 PFAM
Pfam:Glutaredoxin 24 75 1.1e-7 PFAM
Pfam:GST_N_3 26 101 1.9e-21 PFAM
Pfam:GST_N_2 31 96 3.2e-14 PFAM
SCOP:d1eema1 104 242 3e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120645
AA Change: I174F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113409
Gene: ENSMUSG00000025069
AA Change: I174F

DomainStartEndE-ValueType
Pfam:GST_N 22 95 3.8e-14 PFAM
Pfam:Glutaredoxin 24 75 9e-8 PFAM
Pfam:GST_N_3 26 101 6.9e-22 PFAM
Pfam:GST_N_2 31 96 1.7e-14 PFAM
SCOP:d1eema1 104 242 3e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135016
SMART Domains Protein: ENSMUSP00000119680
Gene: ENSMUSG00000025069

DomainStartEndE-ValueType
Pfam:GST_N 23 95 3.4e-10 PFAM
Pfam:Glutaredoxin 24 75 4.4e-8 PFAM
Pfam:GST_N_3 26 101 4.2e-22 PFAM
Pfam:GST_N_2 31 96 6e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an omega class glutathione S-transferase (GST). GSTs are involved in the metabolism of xenobiotics and carcinogens. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 T C 5: 110,237,966 V361A probably damaging Het
Art1 A G 7: 102,106,953 Y117C probably damaging Het
Cecr2 T C 6: 120,754,711 Y215H probably damaging Het
Col6a3 T C 1: 90,768,347 E2666G unknown Het
Cps1 T A 1: 67,209,609 V1165E probably damaging Het
Gm11397 G A 13: 33,404,485 C351Y possibly damaging Het
Gpr65 A T 12: 98,275,629 K180N probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Kif19a A G 11: 114,785,827 D494G probably benign Het
Lnx1 T C 5: 74,597,379 R695G probably damaging Het
Lonp1 A G 17: 56,620,272 L327P probably damaging Het
Nat8 T C 6: 85,830,621 T177A probably damaging Het
Nek1 T A 8: 61,028,675 M208K probably damaging Het
Obsl1 G T 1: 75,492,579 H1239Q probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Prmt3 C T 7: 49,818,108 S354L probably benign Het
Ralgapa1 T A 12: 55,707,978 H1176L probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Strc T C 2: 121,365,115 S1618G probably benign Het
Syne2 T C 12: 76,033,643 S4784P probably damaging Het
Usp14 T C 18: 10,016,623 T73A probably benign Het
Vmn2r53 G A 7: 12,584,774 P458L probably benign Het
Zfp292 T C 4: 34,805,238 D2602G probably damaging Het
Other mutations in Gsto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Gsto2 APN 19 47874967 missense probably damaging 1.00
IGL02561:Gsto2 APN 19 47886190 unclassified probably benign
IGL02820:Gsto2 APN 19 47874959 missense probably damaging 1.00
IGL03141:Gsto2 APN 19 47874873 missense probably damaging 1.00
R4297:Gsto2 UTSW 19 47876496 missense possibly damaging 0.49
R4427:Gsto2 UTSW 19 47871773 missense possibly damaging 0.94
R4701:Gsto2 UTSW 19 47884656 missense probably benign 0.02
R4762:Gsto2 UTSW 19 47874873 missense probably damaging 1.00
R6765:Gsto2 UTSW 19 47871788 nonsense probably null
X0018:Gsto2 UTSW 19 47874901 missense probably benign 0.12
X0067:Gsto2 UTSW 19 47886022 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATCCGTGTCAGGCTAAGGGAAG -3'
(R):5'- ACAGTGGTCTCTGAAGCATGGTGG -3'

Sequencing Primer
(F):5'- GCCAtgtttttttttgttttgttttg -3'
(R):5'- TATTTGGACACGGAACCATGC -3'
Posted On2014-02-11