Incidental Mutation 'R1345:Tulp2'
ID 156460
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Name tubby-like protein 2
Synonyms
MMRRC Submission 039410-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R1345 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45131450-45173070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 45168145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 298 (R298S)
Ref Sequence ENSEMBL: ENSMUSP00000103391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210868] [ENSMUST00000210813] [ENSMUST00000210532] [ENSMUST00000211212]
AlphaFold P46686
Predicted Effect probably benign
Transcript: ENSMUST00000024233
AA Change: R298S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: R298S

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085331
AA Change: R174S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: R174S

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107758
AA Change: R186S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: R186S

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
AA Change: R186S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: R186S

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107762
AA Change: R298S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: R298S

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210868
AA Change: R186S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000210813
AA Change: R186S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Meta Mutation Damage Score 0.0938 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,635,152 (GRCm39) V129I probably damaging Het
Akr1c18 T C 13: 4,195,213 (GRCm39) T82A possibly damaging Het
Alx1 A G 10: 102,864,353 (GRCm39) S39P possibly damaging Het
Atr A G 9: 95,802,408 (GRCm39) T1767A probably benign Het
Brf1 A T 12: 112,924,728 (GRCm39) probably null Het
Cd86 A G 16: 36,438,686 (GRCm39) probably null Het
Cdan1 A G 2: 120,549,620 (GRCm39) probably null Het
Cntln A G 4: 84,892,228 (GRCm39) D371G probably damaging Het
Cypt4 A G 9: 24,536,515 (GRCm39) T2A possibly damaging Het
Dll1 G T 17: 15,593,817 (GRCm39) Y183* probably null Het
Dnmt1 G T 9: 20,819,814 (GRCm39) P1444Q probably damaging Het
Ern2 A G 7: 121,776,993 (GRCm39) L309P probably damaging Het
Fam151a A G 4: 106,599,491 (GRCm39) K142E probably damaging Het
Fbn1 T C 2: 125,156,591 (GRCm39) E2378G probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Kdm5b A C 1: 134,558,288 (GRCm39) T1432P possibly damaging Het
Kif2a G A 13: 107,130,423 (GRCm39) S15F probably damaging Het
Lzic A G 4: 149,571,308 (GRCm39) E31G probably damaging Het
Mmp16 A G 4: 18,112,021 (GRCm39) M466V probably benign Het
Mtm1 T C X: 70,330,837 (GRCm39) V203A probably benign Het
Muc21 T A 17: 35,932,489 (GRCm39) probably benign Het
Neurl4 A G 11: 69,794,702 (GRCm39) M249V probably benign Het
Or6c76b T C 10: 129,692,759 (GRCm39) I124T probably damaging Het
Plxna2 T C 1: 194,326,794 (GRCm39) Y243H probably damaging Het
Rbm44 A G 1: 91,080,481 (GRCm39) N223S probably damaging Het
Sel1l3 G T 5: 53,357,559 (GRCm39) H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,673,060 (GRCm39) probably benign Het
Snrpb2 A G 2: 142,907,086 (GRCm39) probably benign Het
Spata31d1d T G 13: 59,873,838 (GRCm39) K1232N possibly damaging Het
Spink5 A T 18: 44,123,749 (GRCm39) E345D possibly damaging Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tarbp1 T C 8: 127,175,069 (GRCm39) D789G probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tmem232 T C 17: 65,757,401 (GRCm39) N264S possibly damaging Het
Trim43b G C 9: 88,967,725 (GRCm39) L303V possibly damaging Het
Usp42 A G 5: 143,703,088 (GRCm39) V511A probably damaging Het
Vav1 A T 17: 57,608,214 (GRCm39) T321S probably benign Het
Vmn1r169 A C 7: 23,277,247 (GRCm39) H213P probably damaging Het
Vmn1r170 C T 7: 23,305,787 (GRCm39) T63I probably benign Het
Vmn2r103 T G 17: 20,014,509 (GRCm39) W434G probably damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp7 T C 15: 76,774,908 (GRCm39) S317P probably damaging Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45,171,332 (GRCm39) missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45,165,692 (GRCm39) missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45,170,219 (GRCm39) missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45,171,734 (GRCm39) missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45,171,282 (GRCm39) missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45,165,696 (GRCm39) missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0306:Tulp2 UTSW 7 45,168,000 (GRCm39) unclassified probably benign
R0648:Tulp2 UTSW 7 45,169,210 (GRCm39) missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45,170,232 (GRCm39) missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45,167,266 (GRCm39) missense probably benign
R1737:Tulp2 UTSW 7 45,169,201 (GRCm39) missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45,167,367 (GRCm39) missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45,167,365 (GRCm39) missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45,168,052 (GRCm39) missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45,168,187 (GRCm39) missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45,168,176 (GRCm39) missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45,171,298 (GRCm39) missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45,167,348 (GRCm39) missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45,166,075 (GRCm39) missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45,139,797 (GRCm39) splice site probably null
R6294:Tulp2 UTSW 7 45,164,116 (GRCm39) missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45,168,012 (GRCm39) missense probably benign 0.01
R6875:Tulp2 UTSW 7 45,168,038 (GRCm39) missense probably benign 0.05
R7459:Tulp2 UTSW 7 45,169,227 (GRCm39) missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45,168,005 (GRCm39) splice site probably null
R7676:Tulp2 UTSW 7 45,170,451 (GRCm39) missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45,166,188 (GRCm39) splice site probably null
R8775:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8804:Tulp2 UTSW 7 45,170,398 (GRCm39) missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45,171,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGACCTGGAATAGCCAACTG -3'
(R):5'- TGTCCAAGAGGAGCCATCTTCCTAC -3'

Sequencing Primer
(F):5'- TGGCCCACAAGGCCAAG -3'
(R):5'- AGGAGCCATCTTCCTACGATTTG -3'
Posted On 2014-02-11