Incidental Mutation 'R1345:Ern2'
ID 156461
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Name endoplasmic reticulum to nucleus signalling 2
Synonyms Ire1b
MMRRC Submission 039410-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R1345 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 121769116-121785430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121776993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 309 (L309P)
Ref Sequence ENSEMBL: ENSMUSP00000033153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]
AlphaFold Q9Z2E3
Predicted Effect probably damaging
Transcript: ENSMUST00000033153
AA Change: L309P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: L309P

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000206198
AA Change: L309P

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.5709 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,635,152 (GRCm39) V129I probably damaging Het
Akr1c18 T C 13: 4,195,213 (GRCm39) T82A possibly damaging Het
Alx1 A G 10: 102,864,353 (GRCm39) S39P possibly damaging Het
Atr A G 9: 95,802,408 (GRCm39) T1767A probably benign Het
Brf1 A T 12: 112,924,728 (GRCm39) probably null Het
Cd86 A G 16: 36,438,686 (GRCm39) probably null Het
Cdan1 A G 2: 120,549,620 (GRCm39) probably null Het
Cntln A G 4: 84,892,228 (GRCm39) D371G probably damaging Het
Cypt4 A G 9: 24,536,515 (GRCm39) T2A possibly damaging Het
Dll1 G T 17: 15,593,817 (GRCm39) Y183* probably null Het
Dnmt1 G T 9: 20,819,814 (GRCm39) P1444Q probably damaging Het
Fam151a A G 4: 106,599,491 (GRCm39) K142E probably damaging Het
Fbn1 T C 2: 125,156,591 (GRCm39) E2378G probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Kdm5b A C 1: 134,558,288 (GRCm39) T1432P possibly damaging Het
Kif2a G A 13: 107,130,423 (GRCm39) S15F probably damaging Het
Lzic A G 4: 149,571,308 (GRCm39) E31G probably damaging Het
Mmp16 A G 4: 18,112,021 (GRCm39) M466V probably benign Het
Mtm1 T C X: 70,330,837 (GRCm39) V203A probably benign Het
Muc21 T A 17: 35,932,489 (GRCm39) probably benign Het
Neurl4 A G 11: 69,794,702 (GRCm39) M249V probably benign Het
Or6c76b T C 10: 129,692,759 (GRCm39) I124T probably damaging Het
Plxna2 T C 1: 194,326,794 (GRCm39) Y243H probably damaging Het
Rbm44 A G 1: 91,080,481 (GRCm39) N223S probably damaging Het
Sel1l3 G T 5: 53,357,559 (GRCm39) H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,673,060 (GRCm39) probably benign Het
Snrpb2 A G 2: 142,907,086 (GRCm39) probably benign Het
Spata31d1d T G 13: 59,873,838 (GRCm39) K1232N possibly damaging Het
Spink5 A T 18: 44,123,749 (GRCm39) E345D possibly damaging Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tarbp1 T C 8: 127,175,069 (GRCm39) D789G probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tmem232 T C 17: 65,757,401 (GRCm39) N264S possibly damaging Het
Trim43b G C 9: 88,967,725 (GRCm39) L303V possibly damaging Het
Tulp2 C A 7: 45,168,145 (GRCm39) R298S probably benign Het
Usp42 A G 5: 143,703,088 (GRCm39) V511A probably damaging Het
Vav1 A T 17: 57,608,214 (GRCm39) T321S probably benign Het
Vmn1r169 A C 7: 23,277,247 (GRCm39) H213P probably damaging Het
Vmn1r170 C T 7: 23,305,787 (GRCm39) T63I probably benign Het
Vmn2r103 T G 17: 20,014,509 (GRCm39) W434G probably damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp7 T C 15: 76,774,908 (GRCm39) S317P probably damaging Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 121,769,315 (GRCm39) missense probably damaging 0.99
IGL01324:Ern2 APN 7 121,782,413 (GRCm39) missense possibly damaging 0.88
IGL02185:Ern2 APN 7 121,772,598 (GRCm39) splice site probably benign
IGL02738:Ern2 APN 7 121,782,122 (GRCm39) missense probably damaging 0.99
IGL02750:Ern2 APN 7 121,780,629 (GRCm39) splice site probably benign
IGL03247:Ern2 APN 7 121,770,894 (GRCm39) missense probably benign 0.02
ernie UTSW 7 121,770,884 (GRCm39) critical splice donor site probably null
Ernie2 UTSW 7 121,780,085 (GRCm39) splice site probably benign
ernie3 UTSW 7 121,773,042 (GRCm39) critical splice acceptor site probably null
R0165:Ern2 UTSW 7 121,779,002 (GRCm39) missense probably benign 0.02
R0785:Ern2 UTSW 7 121,770,884 (GRCm39) critical splice donor site probably null
R0801:Ern2 UTSW 7 121,780,085 (GRCm39) splice site probably benign
R1649:Ern2 UTSW 7 121,776,623 (GRCm39) missense probably damaging 1.00
R1747:Ern2 UTSW 7 121,773,043 (GRCm39) critical splice acceptor site probably null
R1747:Ern2 UTSW 7 121,773,042 (GRCm39) critical splice acceptor site probably null
R1846:Ern2 UTSW 7 121,775,759 (GRCm39) missense probably benign 0.32
R1899:Ern2 UTSW 7 121,783,065 (GRCm39) splice site probably benign
R1986:Ern2 UTSW 7 121,770,752 (GRCm39) missense probably benign 0.06
R2055:Ern2 UTSW 7 121,783,168 (GRCm39) missense possibly damaging 0.84
R2329:Ern2 UTSW 7 121,772,710 (GRCm39) missense possibly damaging 0.82
R2351:Ern2 UTSW 7 121,770,731 (GRCm39) missense probably damaging 0.97
R2894:Ern2 UTSW 7 121,780,810 (GRCm39) missense possibly damaging 0.94
R3176:Ern2 UTSW 7 121,780,187 (GRCm39) missense possibly damaging 0.89
R3276:Ern2 UTSW 7 121,780,187 (GRCm39) missense possibly damaging 0.89
R3945:Ern2 UTSW 7 121,775,753 (GRCm39) missense probably benign 0.10
R4303:Ern2 UTSW 7 121,777,069 (GRCm39) critical splice acceptor site probably null
R4874:Ern2 UTSW 7 121,775,810 (GRCm39) missense probably benign 0.28
R4943:Ern2 UTSW 7 121,772,481 (GRCm39) missense possibly damaging 0.95
R5184:Ern2 UTSW 7 121,779,182 (GRCm39) missense probably benign 0.03
R5629:Ern2 UTSW 7 121,769,389 (GRCm39) missense probably damaging 1.00
R5770:Ern2 UTSW 7 121,779,130 (GRCm39) missense possibly damaging 0.92
R6255:Ern2 UTSW 7 121,772,495 (GRCm39) missense probably damaging 1.00
R6272:Ern2 UTSW 7 121,775,869 (GRCm39) missense probably benign 0.05
R6277:Ern2 UTSW 7 121,785,330 (GRCm39) missense probably benign
R6624:Ern2 UTSW 7 121,777,006 (GRCm39) missense probably benign 0.00
R6940:Ern2 UTSW 7 121,785,369 (GRCm39) missense probably benign 0.01
R7491:Ern2 UTSW 7 121,769,756 (GRCm39) missense probably damaging 1.00
R7544:Ern2 UTSW 7 121,772,422 (GRCm39) missense probably benign 0.06
R7555:Ern2 UTSW 7 121,769,464 (GRCm39) missense probably damaging 1.00
R7843:Ern2 UTSW 7 121,772,931 (GRCm39) missense probably damaging 1.00
R8281:Ern2 UTSW 7 121,769,483 (GRCm39) missense probably damaging 1.00
R8321:Ern2 UTSW 7 121,772,431 (GRCm39) missense probably damaging 1.00
R8377:Ern2 UTSW 7 121,780,515 (GRCm39) nonsense probably null
R8548:Ern2 UTSW 7 121,777,062 (GRCm39) missense probably damaging 1.00
R8853:Ern2 UTSW 7 121,772,967 (GRCm39) missense probably damaging 1.00
R8929:Ern2 UTSW 7 121,769,363 (GRCm39) missense probably benign 0.03
R8931:Ern2 UTSW 7 121,769,363 (GRCm39) missense probably benign 0.03
R9088:Ern2 UTSW 7 121,772,890 (GRCm39) missense probably damaging 1.00
R9511:Ern2 UTSW 7 121,776,823 (GRCm39) missense probably benign 0.03
R9789:Ern2 UTSW 7 121,769,485 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACCTCATCTGTTGTGGGACC -3'
(R):5'- TGTGGGAGAGTAGGCTTCCTTACC -3'

Sequencing Primer
(F):5'- ATGTGCAAGAAGCCCCTTTC -3'
(R):5'- tgaagggcaactcccaac -3'
Posted On 2014-02-11