Mutagenetix > Incidental Mutation

Incidental Mutation 'R1345:Tarbp1'

156463

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

MMRRC Submission

039410-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1345 (G1)

Quality Score

184

Status

Validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126448330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 789 (D789G)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170518]

AlphaFold

E9Q368

Predicted Effect

probably benign
Transcript: ENSMUST00000170518
AA Change: D789G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: D789G

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Meta Mutation Damage Score

0.0694

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 92.3%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	C	T	12: 110,668,718	V129I	probably damaging	Het
Akr1c18	T	C	13: 4,145,214	T82A	possibly damaging	Het
Alx1	A	G	10: 103,028,492	S39P	possibly damaging	Het
Atr	A	G	9: 95,920,355	T1767A	probably benign	Het
Brf1	A	T	12: 112,961,108		probably null	Het
Cd86	A	G	16: 36,618,324		probably null	Het
Cdan1	A	G	2: 120,719,139		probably null	Het
Cntln	A	G	4: 84,973,991	D371G	probably damaging	Het
Cypt4	A	G	9: 24,625,219	T2A	possibly damaging	Het
Dll1	G	T	17: 15,373,555	Y183*	probably null	Het
Dnmt1	G	T	9: 20,908,518	P1444Q	probably damaging	Het
Ern2	A	G	7: 122,177,770	L309P	probably damaging	Het
Fam151a	A	G	4: 106,742,294	K142E	probably damaging	Het
Fbn1	T	C	2: 125,314,671	E2378G	probably damaging	Het
Gm9573	T	A	17: 35,621,597		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Kdm5b	A	C	1: 134,630,550	T1432P	possibly damaging	Het
Kif2a	G	A	13: 106,993,915	S15F	probably damaging	Het
Lzic	A	G	4: 149,486,851	E31G	probably damaging	Het
Mmp16	A	G	4: 18,112,021	M466V	probably benign	Het
Mtm1	T	C	X: 71,287,231	V203A	probably benign	Het
Neurl4	A	G	11: 69,903,876	M249V	probably benign	Het
Olfr813	T	C	10: 129,856,890	I124T	probably damaging	Het
Plxna2	T	C	1: 194,644,486	Y243H	probably damaging	Het
Rbm44	A	G	1: 91,152,759	N223S	probably damaging	Het
Sel1l3	G	T	5: 53,200,217	H144Q	possibly damaging	Het
Simc1	A	ANNNNNNNNNNNNNNNNNNNNN	13: 54,525,247		probably benign	Het
Snrpb2	A	G	2: 143,065,166		probably benign	Het
Spata31d1d	T	G	13: 59,726,024	K1232N	possibly damaging	Het
Spink5	A	T	18: 43,990,682	E345D	possibly damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tmem232	T	C	17: 65,450,406	N264S	possibly damaging	Het
Trim43b	G	C	9: 89,085,672	L303V	possibly damaging	Het
Tulp2	C	A	7: 45,518,721	R298S	probably benign	Het
Usp42	A	G	5: 143,717,333	V511A	probably damaging	Het
Vav1	A	T	17: 57,301,214	T321S	probably benign	Het
Vmn1r169	A	C	7: 23,577,822	H213P	probably damaging	Het
Vmn1r170	C	T	7: 23,606,362	T63I	probably benign	Het
Vmn2r103	T	G	17: 19,794,247	W434G	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp7	T	C	15: 76,890,708	S317P	probably damaging	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CACGATGCAGCAAACACTGGATTG -3'
(R):5'- CGCAGAGAGCACACACTTGAACTTC -3'

Sequencing Primer
(F):5'- GCAAACACTGGATTGTTGTTAACC -3'
(R):5'- ACTGATGTTCGGCTGCAAC -3'

Posted On

2014-02-11