Incidental Mutation 'R1345:Tarbp1'
ID 156463
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene Name TAR RNA binding protein 1
Synonyms Gm17296
MMRRC Submission 039410-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1345 (G1)
Quality Score 184
Status Validated
Chromosome 8
Chromosomal Location 127152068-127201804 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127175069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 789 (D789G)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
AlphaFold E9Q368
Predicted Effect probably benign
Transcript: ENSMUST00000170518
AA Change: D789G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: D789G

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,635,152 (GRCm39) V129I probably damaging Het
Akr1c18 T C 13: 4,195,213 (GRCm39) T82A possibly damaging Het
Alx1 A G 10: 102,864,353 (GRCm39) S39P possibly damaging Het
Atr A G 9: 95,802,408 (GRCm39) T1767A probably benign Het
Brf1 A T 12: 112,924,728 (GRCm39) probably null Het
Cd86 A G 16: 36,438,686 (GRCm39) probably null Het
Cdan1 A G 2: 120,549,620 (GRCm39) probably null Het
Cntln A G 4: 84,892,228 (GRCm39) D371G probably damaging Het
Cypt4 A G 9: 24,536,515 (GRCm39) T2A possibly damaging Het
Dll1 G T 17: 15,593,817 (GRCm39) Y183* probably null Het
Dnmt1 G T 9: 20,819,814 (GRCm39) P1444Q probably damaging Het
Ern2 A G 7: 121,776,993 (GRCm39) L309P probably damaging Het
Fam151a A G 4: 106,599,491 (GRCm39) K142E probably damaging Het
Fbn1 T C 2: 125,156,591 (GRCm39) E2378G probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Kdm5b A C 1: 134,558,288 (GRCm39) T1432P possibly damaging Het
Kif2a G A 13: 107,130,423 (GRCm39) S15F probably damaging Het
Lzic A G 4: 149,571,308 (GRCm39) E31G probably damaging Het
Mmp16 A G 4: 18,112,021 (GRCm39) M466V probably benign Het
Mtm1 T C X: 70,330,837 (GRCm39) V203A probably benign Het
Muc21 T A 17: 35,932,489 (GRCm39) probably benign Het
Neurl4 A G 11: 69,794,702 (GRCm39) M249V probably benign Het
Or6c76b T C 10: 129,692,759 (GRCm39) I124T probably damaging Het
Plxna2 T C 1: 194,326,794 (GRCm39) Y243H probably damaging Het
Rbm44 A G 1: 91,080,481 (GRCm39) N223S probably damaging Het
Sel1l3 G T 5: 53,357,559 (GRCm39) H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,673,060 (GRCm39) probably benign Het
Snrpb2 A G 2: 142,907,086 (GRCm39) probably benign Het
Spata31d1d T G 13: 59,873,838 (GRCm39) K1232N possibly damaging Het
Spink5 A T 18: 44,123,749 (GRCm39) E345D possibly damaging Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tmem232 T C 17: 65,757,401 (GRCm39) N264S possibly damaging Het
Trim43b G C 9: 88,967,725 (GRCm39) L303V possibly damaging Het
Tulp2 C A 7: 45,168,145 (GRCm39) R298S probably benign Het
Usp42 A G 5: 143,703,088 (GRCm39) V511A probably damaging Het
Vav1 A T 17: 57,608,214 (GRCm39) T321S probably benign Het
Vmn1r169 A C 7: 23,277,247 (GRCm39) H213P probably damaging Het
Vmn1r170 C T 7: 23,305,787 (GRCm39) T63I probably benign Het
Vmn2r103 T G 17: 20,014,509 (GRCm39) W434G probably damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp7 T C 15: 76,774,908 (GRCm39) S317P probably damaging Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 127,185,900 (GRCm39) missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 127,154,894 (GRCm39) missense probably benign 0.03
IGL01475:Tarbp1 APN 8 127,160,701 (GRCm39) missense probably benign 0.03
IGL01688:Tarbp1 APN 8 127,174,290 (GRCm39) missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 127,173,970 (GRCm39) splice site probably benign
IGL02402:Tarbp1 APN 8 127,177,567 (GRCm39) splice site probably benign
IGL02899:Tarbp1 APN 8 127,180,583 (GRCm39) missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 127,170,881 (GRCm39) missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 127,180,574 (GRCm39) missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 127,157,586 (GRCm39) missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 127,174,269 (GRCm39) missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 127,165,667 (GRCm39) splice site probably benign
R0383:Tarbp1 UTSW 8 127,174,223 (GRCm39) missense probably benign 0.00
R0455:Tarbp1 UTSW 8 127,167,612 (GRCm39) missense probably benign 0.00
R0738:Tarbp1 UTSW 8 127,165,540 (GRCm39) critical splice donor site probably null
R1370:Tarbp1 UTSW 8 127,175,069 (GRCm39) missense probably benign 0.03
R1617:Tarbp1 UTSW 8 127,171,007 (GRCm39) missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 127,157,599 (GRCm39) missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 127,154,957 (GRCm39) missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 127,173,786 (GRCm39) missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 127,154,853 (GRCm39) missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 127,154,853 (GRCm39) missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 127,174,333 (GRCm39) splice site probably null
R2877:Tarbp1 UTSW 8 127,154,571 (GRCm39) missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 127,174,160 (GRCm39) missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 127,165,538 (GRCm39) splice site probably benign
R3905:Tarbp1 UTSW 8 127,154,891 (GRCm39) missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 127,167,510 (GRCm39) missense probably benign 0.00
R4420:Tarbp1 UTSW 8 127,173,819 (GRCm39) missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 127,178,972 (GRCm39) missense probably benign 0.00
R4610:Tarbp1 UTSW 8 127,201,069 (GRCm39) missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 127,173,934 (GRCm39) missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 127,201,628 (GRCm39) missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 127,174,184 (GRCm39) missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 127,174,184 (GRCm39) missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 127,193,895 (GRCm39) missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 127,155,709 (GRCm39) missense probably benign 0.16
R5638:Tarbp1 UTSW 8 127,177,425 (GRCm39) missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 127,174,079 (GRCm39) missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 127,193,883 (GRCm39) missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 127,179,667 (GRCm39) missense probably benign 0.05
R6087:Tarbp1 UTSW 8 127,155,709 (GRCm39) missense probably benign 0.00
R6117:Tarbp1 UTSW 8 127,154,280 (GRCm39) missense probably benign 0.00
R6132:Tarbp1 UTSW 8 127,161,548 (GRCm39) missense probably benign 0.17
R6168:Tarbp1 UTSW 8 127,175,144 (GRCm39) missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 127,185,783 (GRCm39) missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 127,177,434 (GRCm39) missense probably benign 0.01
R6766:Tarbp1 UTSW 8 127,174,139 (GRCm39) missense probably benign 0.41
R6775:Tarbp1 UTSW 8 127,163,568 (GRCm39) missense probably benign 0.16
R6960:Tarbp1 UTSW 8 127,155,778 (GRCm39) missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 127,201,234 (GRCm39) missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 127,153,773 (GRCm39) missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 127,184,416 (GRCm39) missense probably benign 0.19
R7519:Tarbp1 UTSW 8 127,160,639 (GRCm39) missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 127,179,546 (GRCm39) missense not run
R7837:Tarbp1 UTSW 8 127,201,300 (GRCm39) missense probably benign 0.00
R7882:Tarbp1 UTSW 8 127,183,232 (GRCm39) missense probably damaging 1.00
R7982:Tarbp1 UTSW 8 127,171,040 (GRCm39) missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 127,153,867 (GRCm39) missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 127,170,934 (GRCm39) missense probably benign 0.29
R8838:Tarbp1 UTSW 8 127,177,569 (GRCm39) splice site probably benign
R8880:Tarbp1 UTSW 8 127,198,044 (GRCm39) missense probably damaging 1.00
R9061:Tarbp1 UTSW 8 127,173,880 (GRCm39) missense probably damaging 1.00
R9123:Tarbp1 UTSW 8 127,174,202 (GRCm39) missense possibly damaging 0.63
R9125:Tarbp1 UTSW 8 127,174,202 (GRCm39) missense possibly damaging 0.63
R9364:Tarbp1 UTSW 8 127,177,462 (GRCm39) missense probably benign 0.01
R9474:Tarbp1 UTSW 8 127,155,779 (GRCm39) missense probably benign 0.44
R9670:Tarbp1 UTSW 8 127,183,262 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CACGATGCAGCAAACACTGGATTG -3'
(R):5'- CGCAGAGAGCACACACTTGAACTTC -3'

Sequencing Primer
(F):5'- GCAAACACTGGATTGTTGTTAACC -3'
(R):5'- ACTGATGTTCGGCTGCAAC -3'
Posted On 2014-02-11