Incidental Mutation 'R1346:Stard9'
ID156494
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 039411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1346 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120713448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 4409 (V4409A)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110700
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110701
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129384
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Predicted Effect probably damaging
Transcript: ENSMUST00000154193
AA Change: V633A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: V633A

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: V4409A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: V4409A

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Meta Mutation Damage Score 0.1707 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.1%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C A 14: 32,660,814 A1065S probably benign Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Arap3 A T 18: 37,975,918 C1228S probably damaging Het
Arfgef1 T C 1: 10,159,733 T1248A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Bdp1 G A 13: 100,078,755 Q374* probably null Het
Cacng6 G T 7: 3,434,922 W255C possibly damaging Het
Camta2 T C 11: 70,676,467 K628R possibly damaging Het
Catsperg1 A T 7: 29,182,334 probably null Het
Cers4 A G 8: 4,515,632 E26G probably damaging Het
Chfr A G 5: 110,140,447 D76G probably damaging Het
Chrng C A 1: 87,208,263 Q245K probably benign Het
Cnn2 T C 10: 79,993,580 probably benign Het
Dyrk2 T C 10: 118,859,719 K545E possibly damaging Het
Eif3d A G 15: 77,968,554 I9T probably damaging Het
Elovl7 A G 13: 108,274,349 I153V probably benign Het
Etl4 T C 2: 20,806,144 S1013P possibly damaging Het
Furin C T 7: 80,392,184 probably benign Het
Gart G T 16: 91,628,182 probably null Het
Gm572 G A 4: 148,654,897 V61M possibly damaging Het
Hspbap1 G A 16: 35,801,665 A127T probably damaging Het
Kcnh2 T C 5: 24,322,660 D898G possibly damaging Het
Kcnrg A G 14: 61,611,695 T202A probably benign Het
Lhx1 T C 11: 84,522,079 E36G possibly damaging Het
Lrp1 T C 10: 127,605,866 N167S probably damaging Het
Parp9 A T 16: 35,956,897 M171L probably benign Het
Pla2g4e G A 2: 120,182,772 R356W probably damaging Het
Ppp4c C T 7: 126,792,050 probably benign Het
Rab3c G A 13: 110,260,586 R49C probably damaging Het
Rbm25 T C 12: 83,644,393 probably benign Het
Sema4g T A 19: 44,997,652 S311T possibly damaging Het
Skida1 T C 2: 18,048,279 I21V possibly damaging Het
Slc25a32 T A 15: 39,100,016 I137F probably benign Het
Stx2 G A 5: 128,988,788 probably benign Het
Timeless C T 10: 128,242,365 T248M possibly damaging Het
Tlr2 T A 3: 83,836,593 N728Y probably damaging Het
Zfp592 A T 7: 81,038,064 N913Y possibly damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
PIT4151001:Stard9 UTSW 2 120702756 nonsense probably null
PIT4498001:Stard9 UTSW 2 120697435 missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense probably benign
R7154:Stard9 UTSW 2 120701314 missense probably benign 0.00
R7154:Stard9 UTSW 2 120704542 missense probably benign 0.02
R7165:Stard9 UTSW 2 120704158 missense probably damaging 1.00
R7260:Stard9 UTSW 2 120706938 missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120634274 nonsense probably null
R7282:Stard9 UTSW 2 120698503 missense probably benign 0.00
R7344:Stard9 UTSW 2 120704686 missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120666534 missense probably benign
R7359:Stard9 UTSW 2 120698280 missense probably damaging 1.00
R7375:Stard9 UTSW 2 120665002 splice site probably null
R7410:Stard9 UTSW 2 120701497 missense probably benign 0.41
R7422:Stard9 UTSW 2 120702152 missense probably benign 0.21
R7475:Stard9 UTSW 2 120688110 missense probably damaging 1.00
R7523:Stard9 UTSW 2 120699597 missense probably benign
R7553:Stard9 UTSW 2 120693808 splice site probably null
R7624:Stard9 UTSW 2 120688146 missense probably benign 0.15
R7761:Stard9 UTSW 2 120699379 missense probably benign 0.00
R7794:Stard9 UTSW 2 120704430 missense probably benign 0.01
R7819:Stard9 UTSW 2 120700984 missense probably damaging 1.00
R7823:Stard9 UTSW 2 120702106 missense probably damaging 0.96
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTGGAAGTAAGTTATTTTGCCGCC -3'
(R):5'- TGCACCTCACAGCACTTTAGCC -3'

Sequencing Primer
(F):5'- TTGCCGCCATGCTTTGG -3'
(R):5'- TCAGTGTTAAGAAGCCCCTG -3'
Posted On2014-02-11