Incidental Mutation 'R1346:Chfr'
ID 156499
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission 039411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock # R1346 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110140447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 76 (D76G)
Ref Sequence ENSEMBL: ENSMUSP00000143737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199283] [ENSMUST00000199557] [ENSMUST00000199672] [ENSMUST00000199811] [ENSMUST00000200038]
AlphaFold Q810L3
Predicted Effect probably damaging
Transcript: ENSMUST00000014812
AA Change: D76G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112519
AA Change: D76G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197010
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably damaging
Transcript: ENSMUST00000198633
AA Change: D76G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199283
SMART Domains Protein: ENSMUSP00000143389
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 50 7e-6 SMART
PDB:1LGQ|B 16 50 8e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Predicted Effect probably damaging
Transcript: ENSMUST00000199811
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143737
Gene: ENSMUSG00000014668
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 5.3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200038
SMART Domains Protein: ENSMUSP00000142354
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 5e-5 SMART
PDB:1LGQ|B 16 46 2e-11 PDB
Meta Mutation Damage Score 0.9361 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.1%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C A 14: 32,660,814 A1065S probably benign Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Arap3 A T 18: 37,975,918 C1228S probably damaging Het
Arfgef1 T C 1: 10,159,733 T1248A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Bdp1 G A 13: 100,078,755 Q374* probably null Het
Cacng6 G T 7: 3,434,922 W255C possibly damaging Het
Camta2 T C 11: 70,676,467 K628R possibly damaging Het
Catsperg1 A T 7: 29,182,334 probably null Het
Cers4 A G 8: 4,515,632 E26G probably damaging Het
Chrng C A 1: 87,208,263 Q245K probably benign Het
Cnn2 T C 10: 79,993,580 probably benign Het
Dyrk2 T C 10: 118,859,719 K545E possibly damaging Het
Eif3d A G 15: 77,968,554 I9T probably damaging Het
Elovl7 A G 13: 108,274,349 I153V probably benign Het
Etl4 T C 2: 20,806,144 S1013P possibly damaging Het
Furin C T 7: 80,392,184 probably benign Het
Gart G T 16: 91,628,182 probably null Het
Gm572 G A 4: 148,654,897 V61M possibly damaging Het
Hspbap1 G A 16: 35,801,665 A127T probably damaging Het
Kcnh2 T C 5: 24,322,660 D898G possibly damaging Het
Kcnrg A G 14: 61,611,695 T202A probably benign Het
Lhx1 T C 11: 84,522,079 E36G possibly damaging Het
Lrp1 T C 10: 127,605,866 N167S probably damaging Het
Parp9 A T 16: 35,956,897 M171L probably benign Het
Pla2g4e G A 2: 120,182,772 R356W probably damaging Het
Ppp4c C T 7: 126,792,050 probably benign Het
Rab3c G A 13: 110,260,586 R49C probably damaging Het
Rbm25 T C 12: 83,644,393 probably benign Het
Sema4g T A 19: 44,997,652 S311T possibly damaging Het
Skida1 T C 2: 18,048,279 I21V possibly damaging Het
Slc25a32 T A 15: 39,100,016 I137F probably benign Het
Stard9 T C 2: 120,713,448 V4409A probably damaging Het
Stx2 G A 5: 128,988,788 probably benign Het
Timeless C T 10: 128,242,365 T248M possibly damaging Het
Tlr2 T A 3: 83,836,593 N728Y probably damaging Het
Zfp592 A T 7: 81,038,064 N913Y possibly damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense probably damaging 1.00
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACCGACTGGAAAAGCAATAATGAAC -3'
(R):5'- CATGAATtagatgggatgcctccatcaa -3'

Sequencing Primer
(F):5'- TGAACCCACAGTAATGTCCAGTG -3'
(R):5'- actatgtcgctctgtctgtatc -3'
Posted On 2014-02-11