Incidental Mutation 'R1346:Elovl7'
ID156515
Institutional Source Beutler Lab
Gene Symbol Elovl7
Ensembl Gene ENSMUSG00000021696
Gene NameELOVL family member 7, elongation of long chain fatty acids (yeast)
Synonyms
MMRRC Submission 039411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1346 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location108214404-108285683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108274349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 153 (I153V)
Ref Sequence ENSEMBL: ENSMUSP00000022207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022207] [ENSMUST00000225550]
Predicted Effect probably benign
Transcript: ENSMUST00000022207
AA Change: I153V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022207
Gene: ENSMUSG00000021696
AA Change: I153V

DomainStartEndE-ValueType
Pfam:ELO 29 269 2.1e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225550
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.1%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C A 14: 32,660,814 A1065S probably benign Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Arap3 A T 18: 37,975,918 C1228S probably damaging Het
Arfgef1 T C 1: 10,159,733 T1248A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Bdp1 G A 13: 100,078,755 Q374* probably null Het
Cacng6 G T 7: 3,434,922 W255C possibly damaging Het
Camta2 T C 11: 70,676,467 K628R possibly damaging Het
Catsperg1 A T 7: 29,182,334 probably null Het
Cers4 A G 8: 4,515,632 E26G probably damaging Het
Chfr A G 5: 110,140,447 D76G probably damaging Het
Chrng C A 1: 87,208,263 Q245K probably benign Het
Cnn2 T C 10: 79,993,580 probably benign Het
Dyrk2 T C 10: 118,859,719 K545E possibly damaging Het
Eif3d A G 15: 77,968,554 I9T probably damaging Het
Etl4 T C 2: 20,806,144 S1013P possibly damaging Het
Furin C T 7: 80,392,184 probably benign Het
Gart G T 16: 91,628,182 probably null Het
Gm572 G A 4: 148,654,897 V61M possibly damaging Het
Hspbap1 G A 16: 35,801,665 A127T probably damaging Het
Kcnh2 T C 5: 24,322,660 D898G possibly damaging Het
Kcnrg A G 14: 61,611,695 T202A probably benign Het
Lhx1 T C 11: 84,522,079 E36G possibly damaging Het
Lrp1 T C 10: 127,605,866 N167S probably damaging Het
Parp9 A T 16: 35,956,897 M171L probably benign Het
Pla2g4e G A 2: 120,182,772 R356W probably damaging Het
Ppp4c C T 7: 126,792,050 probably benign Het
Rab3c G A 13: 110,260,586 R49C probably damaging Het
Rbm25 T C 12: 83,644,393 probably benign Het
Sema4g T A 19: 44,997,652 S311T possibly damaging Het
Skida1 T C 2: 18,048,279 I21V possibly damaging Het
Slc25a32 T A 15: 39,100,016 I137F probably benign Het
Stard9 T C 2: 120,713,448 V4409A probably damaging Het
Stx2 G A 5: 128,988,788 probably benign Het
Timeless C T 10: 128,242,365 T248M possibly damaging Het
Tlr2 T A 3: 83,836,593 N728Y probably damaging Het
Zfp592 A T 7: 81,038,064 N913Y possibly damaging Het
Other mutations in Elovl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Elovl7 APN 13 108274320 missense probably damaging 0.99
IGL01901:Elovl7 APN 13 108274393 critical splice donor site probably null
R1426:Elovl7 UTSW 13 108282494 missense possibly damaging 0.66
R1677:Elovl7 UTSW 13 108282626 missense probably damaging 1.00
R4163:Elovl7 UTSW 13 108267370 missense possibly damaging 0.61
R4207:Elovl7 UTSW 13 108282506 missense possibly damaging 0.76
R5000:Elovl7 UTSW 13 108274381 missense probably benign 0.38
R5467:Elovl7 UTSW 13 108279622 missense probably benign 0.12
R7186:Elovl7 UTSW 13 108271848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTATCCAAACTGGGAGGATGTGCT -3'
(R):5'- CAGGAGTTTAACCAAAGTGGCTCTGAT -3'

Sequencing Primer
(F):5'- CAGCACTTCTTAAATGCTGGG -3'
(R):5'- GTGGCTCTGATTTGAAAAAATTCATC -3'
Posted On2014-02-11