Incidental Mutation 'R1346:Gart'
ID156524
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 039411-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1346 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 91628182 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000023684] [ENSMUST00000156713] [ENSMUST00000156713] [ENSMUST00000232289] [ENSMUST00000232289]
Predicted Effect probably null
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232289
Predicted Effect probably null
Transcript: ENSMUST00000232289
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.1%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C A 14: 32,660,814 A1065S probably benign Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Arap3 A T 18: 37,975,918 C1228S probably damaging Het
Arfgef1 T C 1: 10,159,733 T1248A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Bdp1 G A 13: 100,078,755 Q374* probably null Het
Cacng6 G T 7: 3,434,922 W255C possibly damaging Het
Camta2 T C 11: 70,676,467 K628R possibly damaging Het
Catsperg1 A T 7: 29,182,334 probably null Het
Cers4 A G 8: 4,515,632 E26G probably damaging Het
Chfr A G 5: 110,140,447 D76G probably damaging Het
Chrng C A 1: 87,208,263 Q245K probably benign Het
Cnn2 T C 10: 79,993,580 probably benign Het
Dyrk2 T C 10: 118,859,719 K545E possibly damaging Het
Eif3d A G 15: 77,968,554 I9T probably damaging Het
Elovl7 A G 13: 108,274,349 I153V probably benign Het
Etl4 T C 2: 20,806,144 S1013P possibly damaging Het
Furin C T 7: 80,392,184 probably benign Het
Gm572 G A 4: 148,654,897 V61M possibly damaging Het
Hspbap1 G A 16: 35,801,665 A127T probably damaging Het
Kcnh2 T C 5: 24,322,660 D898G possibly damaging Het
Kcnrg A G 14: 61,611,695 T202A probably benign Het
Lhx1 T C 11: 84,522,079 E36G possibly damaging Het
Lrp1 T C 10: 127,605,866 N167S probably damaging Het
Parp9 A T 16: 35,956,897 M171L probably benign Het
Pla2g4e G A 2: 120,182,772 R356W probably damaging Het
Ppp4c C T 7: 126,792,050 probably benign Het
Rab3c G A 13: 110,260,586 R49C probably damaging Het
Rbm25 T C 12: 83,644,393 probably benign Het
Sema4g T A 19: 44,997,652 S311T possibly damaging Het
Skida1 T C 2: 18,048,279 I21V possibly damaging Het
Slc25a32 T A 15: 39,100,016 I137F probably benign Het
Stard9 T C 2: 120,713,448 V4409A probably damaging Het
Stx2 G A 5: 128,988,788 probably benign Het
Timeless C T 10: 128,242,365 T248M possibly damaging Het
Tlr2 T A 3: 83,836,593 N728Y probably damaging Het
Zfp592 A T 7: 81,038,064 N913Y possibly damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 splice site probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTTTCCAGCAGACGAGCTTAC -3'
(R):5'- TGGTCTTCACAGCAATGGGTTTAGC -3'

Sequencing Primer
(F):5'- GCAGACGAGCTTACCTAAATCTAC -3'
(R):5'- CAGACCTTAGGTAAACGGACTCTTG -3'
Posted On2014-02-11