Incidental Mutation 'R1347:Gpd2'
ID156528
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Nameglycerol phosphate dehydrogenase 2, mitochondrial
SynonymsGdm1
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location57237635-57370719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57357671 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 542 (K542M)
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]
Predicted Effect probably damaging
Transcript: ENSMUST00000028167
AA Change: K542M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: K542M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112618
AA Change: K542M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: K542M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141536
Predicted Effect probably damaging
Transcript: ENSMUST00000169687
AA Change: K542M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: K542M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57268084 critical splice donor site probably null
IGL01012:Gpd2 APN 2 57364530 missense probably benign 0.00
IGL01096:Gpd2 APN 2 57338867 missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57268071 nonsense probably null
IGL01816:Gpd2 APN 2 57364066 nonsense probably null
IGL02257:Gpd2 APN 2 57364524 missense probably benign 0.01
IGL02824:Gpd2 APN 2 57364327 missense probably null 0.89
IGL02832:Gpd2 APN 2 57338979 missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57355793 missense probably benign 0.06
IGL03107:Gpd2 APN 2 57355569 missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57338843 splice site probably benign
IGL03218:Gpd2 APN 2 57307054 missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57304486 critical splice donor site probably null
IGL03372:Gpd2 APN 2 57355507 missense probably damaging 1.00
kraft UTSW 2 57304396 missense probably damaging 0.96
R0012:Gpd2 UTSW 2 57338868 missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57338955 missense probably benign 0.16
R0379:Gpd2 UTSW 2 57345263 missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57340093 missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57355475 missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57357700 missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57357655 missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57355551 missense probably damaging 1.00
R2056:Gpd2 UTSW 2 57339013 critical splice donor site probably null
R2959:Gpd2 UTSW 2 57338975 nonsense probably null
R2960:Gpd2 UTSW 2 57338975 nonsense probably null
R2961:Gpd2 UTSW 2 57338975 nonsense probably null
R2962:Gpd2 UTSW 2 57338975 nonsense probably null
R3008:Gpd2 UTSW 2 57338975 nonsense probably null
R3009:Gpd2 UTSW 2 57338975 nonsense probably null
R3881:Gpd2 UTSW 2 57338975 nonsense probably null
R4073:Gpd2 UTSW 2 57290013 missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57355771 missense probably damaging 1.00
R4564:Gpd2 UTSW 2 57307083 missense possibly damaging 0.77
R4952:Gpd2 UTSW 2 57307013 nonsense probably null
R5030:Gpd2 UTSW 2 57304405 missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57355901 missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57340204 missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57364513 missense probably benign 0.18
R6325:Gpd2 UTSW 2 57304396 missense probably damaging 0.96
R6536:Gpd2 UTSW 2 57345355 missense probably benign 0.40
R6923:Gpd2 UTSW 2 57355788 missense probably damaging 0.98
R7058:Gpd2 UTSW 2 57307100 splice site probably null
R7380:Gpd2 UTSW 2 57340159 missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57306950 nonsense probably null
R8098:Gpd2 UTSW 2 57290008 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGTACCTGTGCCTGATGGAGAG -3'
(R):5'- ACCTAGAAAAGGCTGCATCCAACTG -3'

Sequencing Primer
(F):5'- GCCTGATGGAGAGCCAGAG -3'
(R):5'- GACCAAGCTGTTACATGGTTACC -3'
Posted On2014-02-11