Incidental Mutation 'R1347:Rims3'
ID156530
Institutional Source Beutler Lab
Gene Symbol Rims3
Ensembl Gene ENSMUSG00000032890
Gene Nameregulating synaptic membrane exocytosis 3
SynonymsA730060M23Rik, Nim3, Rim3
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location120854816-120896579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120883125 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 90 (G90S)
Ref Sequence ENSEMBL: ENSMUSP00000130295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071093] [ENSMUST00000106283] [ENSMUST00000171363]
Predicted Effect probably damaging
Transcript: ENSMUST00000071093
AA Change: G90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068178
Gene: ENSMUSG00000032890
AA Change: G90S

DomainStartEndE-ValueType
low complexity region 33 42 N/A INTRINSIC
C2 169 272 6.64e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106283
AA Change: G90S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101890
Gene: ENSMUSG00000032890
AA Change: G90S

DomainStartEndE-ValueType
low complexity region 33 42 N/A INTRINSIC
C2 169 272 6.64e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132895
Predicted Effect probably damaging
Transcript: ENSMUST00000171363
AA Change: G90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130295
Gene: ENSMUSG00000032890
AA Change: G90S

DomainStartEndE-ValueType
low complexity region 33 42 N/A INTRINSIC
C2 169 272 6.64e-12 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Rims3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Rims3 APN 4 120891386 missense probably benign 0.30
IGL01358:Rims3 APN 4 120891503 missense possibly damaging 0.91
R0145:Rims3 UTSW 4 120887026 missense probably damaging 1.00
R1347:Rims3 UTSW 4 120883125 missense probably damaging 1.00
R1998:Rims3 UTSW 4 120891358 missense probably benign
R3708:Rims3 UTSW 4 120883155 missense probably damaging 0.97
R4703:Rims3 UTSW 4 120883297 intron probably benign
R5274:Rims3 UTSW 4 120891374 missense probably damaging 1.00
R6331:Rims3 UTSW 4 120883153 missense probably damaging 0.96
Z1176:Rims3 UTSW 4 120889072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCTGCCTCTGTTCAGAGAATC -3'
(R):5'- TGCAGGCATCTTGGCTGGAAAG -3'

Sequencing Primer
(F):5'- CAGAGAATCTCTTTGGTAGCACTC -3'
(R):5'- CCCTCGGAGCTGTTGCTATG -3'
Posted On2014-02-11