Incidental Mutation 'R1347:Vmn1r11'
ID156534
Institutional Source Beutler Lab
Gene Symbol Vmn1r11
Ensembl Gene ENSMUSG00000115236
Gene Namevomeronasal 1 receptor 11
SynonymsV1rc3
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57133455-57139617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57137978 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 209 (C209Y)
Ref Sequence ENSEMBL: ENSMUSP00000154588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071304] [ENSMUST00000176954] [ENSMUST00000226968] [ENSMUST00000228235]
Predicted Effect probably benign
Transcript: ENSMUST00000071304
AA Change: C209Y

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071272
Gene: ENSMUSG00000115236
AA Change: C209Y

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.5e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176954
AA Change: C209Y

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135192
Gene: ENSMUSG00000093635
AA Change: C209Y

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226968
AA Change: C209Y

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000228235
AA Change: C172Y

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Vmn1r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Vmn1r11 APN 6 57138037 missense possibly damaging 0.66
IGL02141:Vmn1r11 APN 6 57137379 nonsense probably null
IGL03147:Vmn1r11 UTSW 6 57137665 missense probably damaging 0.98
R0908:Vmn1r11 UTSW 6 57138064 missense probably damaging 1.00
R1185:Vmn1r11 UTSW 6 57137507 missense possibly damaging 0.89
R1185:Vmn1r11 UTSW 6 57137507 missense possibly damaging 0.89
R1185:Vmn1r11 UTSW 6 57137507 missense possibly damaging 0.89
R1347:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1348:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1349:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1373:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1497:Vmn1r11 UTSW 6 57137409 missense probably damaging 1.00
R2147:Vmn1r11 UTSW 6 57137598 missense probably benign 0.29
R2367:Vmn1r11 UTSW 6 57137431 missense probably benign 0.00
R3087:Vmn1r11 UTSW 6 57137706 missense possibly damaging 0.94
R4445:Vmn1r11 UTSW 6 57137530 missense probably benign 0.31
R4667:Vmn1r11 UTSW 6 57137498 missense probably damaging 1.00
R4769:Vmn1r11 UTSW 6 57137612 missense probably damaging 1.00
R5513:Vmn1r11 UTSW 6 57137632 missense probably damaging 0.97
R5841:Vmn1r11 UTSW 6 57137802 missense probably damaging 1.00
R6089:Vmn1r11 UTSW 6 57137660 missense possibly damaging 0.95
R7155:Vmn1r11 UTSW 6 57138162 missense probably benign 0.07
R7359:Vmn1r11 UTSW 6 57138199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAATACCTCGCTGTTGGCAAAA -3'
(R):5'- GTCAGGATGACTGGGTCATACATCCAT -3'

Sequencing Primer
(F):5'- GTGCTTATACCAATGTGAGTGAGAC -3'
(R):5'- TGGGTCATACATCCATAACAGG -3'
Posted On2014-02-11