Incidental Mutation 'R1347:Foxa1'
ID156540
Institutional Source Beutler Lab
Gene Symbol Foxa1
Ensembl Gene ENSMUSG00000035451
Gene Nameforkhead box A1
SynonymsHnf3a, Hnf-3a, Tcf3a, Tcf-3a
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location57540628-57546916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57542284 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 383 (H383Q)
Ref Sequence ENSEMBL: ENSMUSP00000041118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044380]
Predicted Effect probably damaging
Transcript: ENSMUST00000044380
AA Change: H383Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041118
Gene: ENSMUSG00000035451
AA Change: H383Q

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
FH 168 258 3.88e-62 SMART
low complexity region 273 286 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
Pfam:HNF_C 393 457 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218398
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal feeding, hypoglycemia, impaired glucagon secretion, hypotryglyceridemia, wasting, and lethality between postnatal days 2 and 14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Foxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Foxa1 APN 12 57542657 missense probably damaging 1.00
IGL02371:Foxa1 APN 12 57542700 missense probably damaging 0.98
IGL03150:Foxa1 APN 12 57542296 missense probably benign 0.41
PIT4377001:Foxa1 UTSW 12 57542781 missense probably damaging 1.00
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1494:Foxa1 UTSW 12 57542198 missense probably damaging 0.99
R1598:Foxa1 UTSW 12 57542687 missense possibly damaging 0.69
R1809:Foxa1 UTSW 12 57542741 missense probably damaging 1.00
R5554:Foxa1 UTSW 12 57542291 missense probably benign 0.00
R5667:Foxa1 UTSW 12 57542295 missense probably benign 0.01
R5782:Foxa1 UTSW 12 57542516 missense probably benign 0.00
R6174:Foxa1 UTSW 12 57542900 missense probably damaging 1.00
R6750:Foxa1 UTSW 12 57542610 missense probably benign 0.32
R6781:Foxa1 UTSW 12 57543257 missense possibly damaging 0.74
R6995:Foxa1 UTSW 12 57542478 missense probably benign 0.00
R7209:Foxa1 UTSW 12 57543291 missense probably benign 0.03
R7864:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
R7947:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
X0020:Foxa1 UTSW 12 57543312 missense possibly damaging 0.73
Z1177:Foxa1 UTSW 12 57542417 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGACAAAACCCTCAGTTCTGGGAG -3'
(R):5'- TTCGAGAACGGCTGCTACTTGC -3'

Sequencing Primer
(F):5'- ATACACACCTTGGTAGTAGGCTG -3'
(R):5'- TAGCCAGCTAGAgggcg -3'
Posted On2014-02-11