Incidental Mutation 'R1347:Vmn2r114'
ID156547
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Namevomeronasal 2, receptor 114
SynonymsEG666002
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1347 (G1)
Quality Score113
Status Not validated
Chromosome17
Chromosomal Location23290934-23312313 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) ATTT to ATT at 23290932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
Predicted Effect probably null
Transcript: ENSMUST00000168033
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23291665 missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23290965 missense probably benign
IGL00990:Vmn2r114 APN 17 23290983 missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23291238 missense probably damaging 1.00
IGL01838:Vmn2r114 APN 17 23296982 missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23310381 missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23310477 missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23291808 missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23311134 missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23310520 missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23291289 missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23296996 splice site probably benign
IGL03325:Vmn2r114 APN 17 23291678 missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23310575 nonsense probably null
R0164:Vmn2r114 UTSW 17 23309826 critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23290943 missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23290932 makesense probably null
R0677:Vmn2r114 UTSW 17 23310594 missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23290932 makesense probably null
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23310340 missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23290932 makesense probably null
R1435:Vmn2r114 UTSW 17 23290932 makesense probably null
R1437:Vmn2r114 UTSW 17 23291211 missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23291701 missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23296988 missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23308061 missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23311112 missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23291109 missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23290932 makesense probably null
R2113:Vmn2r114 UTSW 17 23290932 makesense probably null
R2134:Vmn2r114 UTSW 17 23291763 missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23290932 makesense probably null
R2424:Vmn2r114 UTSW 17 23296868 missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23290932 makesense probably null
R3017:Vmn2r114 UTSW 17 23290932 makesense probably null
R3018:Vmn2r114 UTSW 17 23290932 makesense probably null
R3019:Vmn2r114 UTSW 17 23290932 makesense probably null
R3020:Vmn2r114 UTSW 17 23290932 makesense probably null
R3021:Vmn2r114 UTSW 17 23290932 makesense probably null
R4628:Vmn2r114 UTSW 17 23290932 makesense probably null
R4668:Vmn2r114 UTSW 17 23310473 missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23291379 missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23291791 missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23291658 missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23290932 makesense probably null
R5405:Vmn2r114 UTSW 17 23290932 makesense probably null
R5449:Vmn2r114 UTSW 17 23290932 makesense probably null
R5615:Vmn2r114 UTSW 17 23290932 makesense probably null
R5834:Vmn2r114 UTSW 17 23310625 missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23291295 missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23290980 missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23309965 missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23291668 missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23310246 missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23309876 missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23310202 missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23291130 missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23310163 missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23290960 missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23291494 missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23308061 missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23310637 missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23291026 missense probably benign 0.01
R7585:Vmn2r114 UTSW 17 23291265 missense probably damaging 1.00
R7593:Vmn2r114 UTSW 17 23291843 nonsense probably null
R7611:Vmn2r114 UTSW 17 23296970 missense probably damaging 0.97
R7641:Vmn2r114 UTSW 17 23308203 missense possibly damaging 0.53
R7651:Vmn2r114 UTSW 17 23291012 nonsense probably null
X0065:Vmn2r114 UTSW 17 23310957 missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23290932 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACGAGAATATTGAAAAGCAGACTCCCAG -3'
(R):5'- TGTTTACCATAGCACCAAAGGCAGG -3'

Sequencing Primer
(F):5'- gcaacccaaaaaagagcatctg -3'
(R):5'- CAAAGGCAGGGTCATGGTG -3'
Posted On2014-02-11