Incidental Mutation 'R1348:Racgap1'
ID156580
Institutional Source Beutler Lab
Gene Symbol Racgap1
Ensembl Gene ENSMUSG00000023015
Gene NameRac GTPase-activating protein 1
SynonymsBand25, gtl11, GTPase, MgcRacGAP
MMRRC Submission 039413-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1348 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99620496-99651656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99626365 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 387 (I387T)
Ref Sequence ENSEMBL: ENSMUSP00000126417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023756] [ENSMUST00000168065] [ENSMUST00000171702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023756
AA Change: I387T

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023756
Gene: ENSMUSG00000023015
AA Change: I387T

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165745
Predicted Effect probably benign
Transcript: ENSMUST00000168065
SMART Domains Protein: ENSMUSP00000132732
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 6 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171017
Predicted Effect possibly damaging
Transcript: ENSMUST00000171702
AA Change: I387T

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126417
Gene: ENSMUSG00000023015
AA Change: I387T

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: Embryos homozygous for a gene-trapped allele exhibit pre-implantation lethality associated with the formation of multinucleated blastomeres and failure to complete cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,374,238 probably null Het
Art1 G A 7: 102,107,372 A33T possibly damaging Het
Aspa G A 11: 73,324,483 T2I probably damaging Het
Cntn1 C T 15: 92,314,663 T902I probably damaging Het
Dpep1 G A 8: 123,199,160 C118Y probably benign Het
Fam35a T A 14: 34,268,923 I9F probably damaging Het
Fam71f2 A G 6: 29,283,285 H36R probably benign Het
Gucy2g C T 19: 55,222,906 V631I possibly damaging Het
Igf1r C G 7: 68,218,468 N1220K probably damaging Het
Insr A T 8: 3,192,635 I28N probably damaging Het
Katnal2 T C 18: 76,978,542 probably null Het
Klrb1a T C 6: 128,609,834 D156G possibly damaging Het
Kpna6 G A 4: 129,661,359 R26* probably null Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Naa15 C G 3: 51,465,670 C661W probably damaging Het
Olfr20 G T 11: 73,353,856 M34I probably benign Het
Olfr44 A G 9: 39,485,236 S3P probably benign Het
Olfr978 T C 9: 39,993,828 I6T probably benign Het
Paxbp1 A G 16: 91,035,016 V328A probably damaging Het
Pkd1l1 T C 11: 8,834,806 T1993A probably benign Het
Pold1 C T 7: 44,534,682 V865I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rbms2 C T 10: 128,176,345 probably null Het
Recql4 A G 15: 76,709,211 I140T probably benign Het
Sorl1 A T 9: 42,000,412 probably null Het
Speg G A 1: 75,422,872 G2321D probably damaging Het
Trp53tg5 A G 2: 164,473,601 probably null Het
Tyw3 A C 3: 154,593,814 M86R possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Zfp472 T A 17: 32,977,820 F290I probably benign Het
Other mutations in Racgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Racgap1 APN 15 99636122 unclassified probably benign
IGL01450:Racgap1 APN 15 99626363 missense probably benign 0.00
IGL01907:Racgap1 APN 15 99626333 nonsense probably null
IGL02584:Racgap1 APN 15 99623634 missense probably benign 0.00
IGL02733:Racgap1 APN 15 99639704 missense probably damaging 1.00
IGL03137:Racgap1 APN 15 99628741 missense probably damaging 0.96
IGL03145:Racgap1 APN 15 99623640 missense probably benign 0.00
IGL02799:Racgap1 UTSW 15 99632747 missense probably benign 0.09
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0140:Racgap1 UTSW 15 99623651 missense probably benign 0.00
R0398:Racgap1 UTSW 15 99628627 splice site probably benign
R0496:Racgap1 UTSW 15 99639832 splice site probably benign
R0528:Racgap1 UTSW 15 99628706 missense probably damaging 1.00
R0893:Racgap1 UTSW 15 99626530 missense probably benign
R0947:Racgap1 UTSW 15 99624314 missense possibly damaging 0.83
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1720:Racgap1 UTSW 15 99628769 nonsense probably null
R2235:Racgap1 UTSW 15 99626536 missense probably benign
R3624:Racgap1 UTSW 15 99642891 missense probably damaging 0.97
R4621:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4622:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4623:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R5046:Racgap1 UTSW 15 99628762 missense probably damaging 1.00
R5899:Racgap1 UTSW 15 99623628 missense possibly damaging 0.80
R6306:Racgap1 UTSW 15 99623953 missense probably benign
R6513:Racgap1 UTSW 15 99624275 missense probably damaging 1.00
R6618:Racgap1 UTSW 15 99623994 missense probably damaging 0.97
R6953:Racgap1 UTSW 15 99626329 missense probably damaging 1.00
R7359:Racgap1 UTSW 15 99631200 missense probably benign
R7463:Racgap1 UTSW 15 99642958 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCCACAGTCAAGTTCTGCCTTC -3'
(R):5'- TCGGCAGTGTAAATAACAAAGCCCC -3'

Sequencing Primer
(F):5'- ACCTGCTGCCTCCATGAAG -3'
(R):5'- GTGTAAATAACAAAGCCCCTTCTTC -3'
Posted On2014-02-11