Incidental Mutation 'R1349:Clspn'
ID156594
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Nameclaspin
SynonymsC85083, E130314M08Rik
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126556935-126593903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126563977 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 98 (A98V)
Ref Sequence ENSEMBL: ENSMUSP00000120683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795] [ENSMUST00000147675]
Predicted Effect probably benign
Transcript: ENSMUST00000048391
AA Change: A267V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: A267V

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123695
Predicted Effect probably benign
Transcript: ENSMUST00000126512
SMART Domains Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
low complexity region 221 242 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129795
AA Change: A98V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: A98V

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147675
SMART Domains Protein: ENSMUSP00000116699
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185054
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126573178 missense probably damaging 1.00
IGL02160:Clspn APN 4 126581510 missense probably benign 0.21
IGL02231:Clspn APN 4 126559228 missense probably damaging 0.98
IGL02281:Clspn APN 4 126565770 missense possibly damaging 0.90
IGL02368:Clspn APN 4 126566107 missense probably benign
IGL03149:Clspn APN 4 126576502 splice site probably benign
Durch UTSW 4 126580962 missense probably damaging 0.99
R0012:Clspn UTSW 4 126564929 unclassified probably benign
R0035:Clspn UTSW 4 126565003 splice site probably null
R0035:Clspn UTSW 4 126565003 splice site probably null
R0207:Clspn UTSW 4 126590598 missense possibly damaging 0.82
R0270:Clspn UTSW 4 126573236 missense probably damaging 1.00
R0825:Clspn UTSW 4 126573130 splice site probably benign
R1082:Clspn UTSW 4 126577779 missense possibly damaging 0.95
R1568:Clspn UTSW 4 126581517 missense probably benign 0.01
R1649:Clspn UTSW 4 126566435 unclassified probably benign
R1663:Clspn UTSW 4 126565975 missense probably benign 0.00
R2497:Clspn UTSW 4 126572347 missense possibly damaging 0.79
R3107:Clspn UTSW 4 126591659 missense probably benign 0.06
R3951:Clspn UTSW 4 126576379 missense probably damaging 1.00
R3953:Clspn UTSW 4 126566437 frame shift probably null
R3954:Clspn UTSW 4 126566437 frame shift probably null
R3956:Clspn UTSW 4 126566437 frame shift probably null
R4599:Clspn UTSW 4 126581460 missense probably benign 0.14
R4717:Clspn UTSW 4 126560056 missense probably damaging 1.00
R4853:Clspn UTSW 4 126566555 missense probably damaging 0.99
R4854:Clspn UTSW 4 126575950 missense probably benign
R4979:Clspn UTSW 4 126578386 missense probably damaging 1.00
R5363:Clspn UTSW 4 126561786 missense possibly damaging 0.58
R5531:Clspn UTSW 4 126577773 missense probably benign
R5614:Clspn UTSW 4 126580962 missense probably damaging 0.99
R5706:Clspn UTSW 4 126578418 missense probably damaging 1.00
R5806:Clspn UTSW 4 126586106 missense probably damaging 1.00
R6106:Clspn UTSW 4 126590641 missense probably benign 0.00
R6178:Clspn UTSW 4 126577736 splice site probably null
R6223:Clspn UTSW 4 126586168 missense probably damaging 0.99
R6326:Clspn UTSW 4 126565739 missense probably damaging 1.00
R6398:Clspn UTSW 4 126563947 missense probably damaging 1.00
R6714:Clspn UTSW 4 126565768 missense probably damaging 1.00
R7003:Clspn UTSW 4 126592720 missense possibly damaging 0.63
R7034:Clspn UTSW 4 126580982 missense possibly damaging 0.87
R7358:Clspn UTSW 4 126566200 missense probably benign 0.02
R7376:Clspn UTSW 4 126590637 missense possibly damaging 0.65
R7675:Clspn UTSW 4 126566320 missense probably benign 0.00
R8320:Clspn UTSW 4 126563950 missense possibly damaging 0.73
T0975:Clspn UTSW 4 126566437 unclassified probably benign
X0014:Clspn UTSW 4 126575943 missense probably damaging 1.00
Z1177:Clspn UTSW 4 126566177 missense probably benign
Predicted Primers PCR Primer
(F):5'- gTCCAAACAGAAAACTTAGGGCTATAATTCCA -3'
(R):5'- aCATACAGATACACAcaggcaaaacaca -3'

Sequencing Primer
(F):5'- gcaagttcaaagccagcc -3'
(R):5'- tgtggtacacacacatgcag -3'
Posted On2014-02-11