Mutagenetix > Incidental Mutation

Incidental Mutation 'R1349:Vmn2r12'

156595

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r12

Ensembl Gene

ENSMUSG00000090688

Gene Name

vomeronasal 2, receptor 12

Synonyms

Gm6769

MMRRC Submission

039414-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1349 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109085849-109097864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109086586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 587 (M587V)

Ref Sequence

ENSEMBL: ENSMUSP00000093612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095922]

AlphaFold

L7N217

Predicted Effect

probably benign
Transcript: ENSMUST00000095922
AA Change: M587V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: M587V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.8e-30	PFAM
Pfam:NCD3G	505	559	1.7e-18	PFAM
Pfam:7tm_3	591	827	3.9e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.8%

Validation Efficiency

98% (46/47)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	G	A	8: 124,861,253	T36I	possibly damaging	Het
Adcy2	T	A	13: 68,668,533	N778I	probably damaging	Het
Ak5	G	T	3: 152,533,434	D301E	probably damaging	Het
Akap13	G	A	7: 75,609,592	G655S	possibly damaging	Het
Ankrd28	A	T	14: 31,745,261	M248K	probably benign	Het
Atf7ip2	G	A	16: 10,234,331	V225I	probably damaging	Het
Ccdc151	C	T	9: 21,993,620	R290H	probably damaging	Het
Ccdc157	A	T	11: 4,149,056	I48N	probably benign	Het
Cd209d	C	A	8: 3,878,515		probably benign	Het
Cecr2	G	A	6: 120,757,603	G613E	probably damaging	Het
Clspn	C	T	4: 126,563,977	A98V	probably benign	Het
Cntnap5b	G	A	1: 100,164,088	D499N	probably benign	Het
Cox7a2	G	A	9: 79,758,537	R21*	probably null	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Dbpht2	C	CNNNNNNNNNNNNNNNNNN	12: 74,299,062		noncoding transcript	Het
Dlg1	T	C	16: 31,812,820	I208T	probably damaging	Het
Dmxl1	A	T	18: 49,888,853	N1612Y	probably damaging	Het
Epha3	A	G	16: 63,611,053	I495T	possibly damaging	Het
Frem1	T	C	4: 82,922,305		probably benign	Het
Glipr1	A	G	10: 111,993,532	V108A	probably benign	Het
Gm4778	A	G	3: 94,266,128	T148A	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,709	L287P	possibly damaging	Het
Hp	T	G	8: 109,575,306	K337Q	probably benign	Het
Htr1a	T	A	13: 105,445,366	C371*	probably null	Het
Leo1	T	C	9: 75,449,469	V377A	possibly damaging	Het
Lsg1	A	G	16: 30,564,654	F583L	possibly damaging	Het
Map4k4	C	A	1: 40,021,159	P1103Q	probably damaging	Het
Mybph	T	C	1: 134,193,615	S38P	probably benign	Het
Myo1e	T	G	9: 70,287,069		probably benign	Het
Nefh	T	TNNNNNNNNNNNNNNNNNN	11: 4,941,010		probably benign	Het
Oca2	T	A	7: 56,535,968	M814K	probably benign	Het
Pkd1	T	C	17: 24,575,266	C1976R	probably damaging	Het
Pogz	T	A	3: 94,860,888	L126M	probably damaging	Het
Rec8	T	C	14: 55,618,974	Y68H	probably damaging	Het
Ryr3	T	A	2: 112,834,201	S1582C	probably damaging	Het
Sh3pxd2a	A	T	19: 47,267,721	W853R	probably damaging	Het
Slc6a7	C	T	18: 61,000,543	G527D	probably benign	Het
Tgm1	A	G	14: 55,711,201		probably benign	Het
Tnxb	T	C	17: 34,710,293	V2770A	possibly damaging	Het
Togaram1	T	A	12: 65,011,145	M1502K	probably damaging	Het
Vmn1r11	G	A	6: 57,137,978	C209Y	probably benign	Het
Vmn2r102	A	T	17: 19,660,625		probably benign	Het
Vmn2r63	A	G	7: 42,929,218	F84L	possibly damaging	Het
Wdr35	A	T	12: 9,019,870		probably benign	Het
Wdr73	C	A	7: 80,893,252	V176L	probably damaging	Het

Other mutations in Vmn2r12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Vmn2r12	APN	5	109097675	missense	possibly damaging	0.47
IGL01096:Vmn2r12	APN	5	109086259	missense	probably damaging	1.00
IGL01538:Vmn2r12	APN	5	109091850	missense	probably damaging	1.00
IGL01548:Vmn2r12	APN	5	109093027	nonsense	probably null
IGL01762:Vmn2r12	APN	5	109086564	missense	probably damaging	0.99
IGL01860:Vmn2r12	APN	5	109092159	missense	probably benign	0.10
IGL02269:Vmn2r12	APN	5	109086477	missense	probably damaging	1.00
IGL02530:Vmn2r12	APN	5	109085992	missense	probably damaging	1.00
IGL02887:Vmn2r12	APN	5	109090485	missense	probably benign	0.03
IGL03265:Vmn2r12	APN	5	109092070	missense	probably benign	0.05
R0396:Vmn2r12	UTSW	5	109092899	missense	probably benign	0.00
R0497:Vmn2r12	UTSW	5	109091889	nonsense	probably null
R0529:Vmn2r12	UTSW	5	109092848	missense	probably benign
R0715:Vmn2r12	UTSW	5	109090507	missense	probably benign	0.10
R0742:Vmn2r12	UTSW	5	109086415	missense	possibly damaging	0.55
R0894:Vmn2r12	UTSW	5	109087850	critical splice donor site	probably null
R1173:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1174:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1259:Vmn2r12	UTSW	5	109091897	missense	probably damaging	0.97
R1388:Vmn2r12	UTSW	5	109092974	missense	possibly damaging	0.56
R1549:Vmn2r12	UTSW	5	109092830	missense	probably benign	0.06
R1766:Vmn2r12	UTSW	5	109092044	missense	probably damaging	1.00
R1781:Vmn2r12	UTSW	5	109091728	missense	probably benign	0.00
R1885:Vmn2r12	UTSW	5	109092076	missense	probably damaging	1.00
R2159:Vmn2r12	UTSW	5	109091474	missense	probably benign	0.02
R2420:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2421:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2422:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2937:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R2938:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R3898:Vmn2r12	UTSW	5	109090504	missense	probably benign	0.02
R4061:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4063:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4090:Vmn2r12	UTSW	5	109091546	missense	probably benign	0.06
R4297:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4298:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4299:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4304:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4306:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4307:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4308:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4594:Vmn2r12	UTSW	5	109086435	missense	probably damaging	1.00
R4783:Vmn2r12	UTSW	5	109086513	missense	probably damaging	1.00
R4900:Vmn2r12	UTSW	5	109092986	missense	probably damaging	1.00
R4929:Vmn2r12	UTSW	5	109091678	missense	probably damaging	1.00
R4974:Vmn2r12	UTSW	5	109091506	missense	probably damaging	1.00
R5389:Vmn2r12	UTSW	5	109090395	missense	probably benign	0.00
R5431:Vmn2r12	UTSW	5	109091818	missense	probably damaging	0.99
R5527:Vmn2r12	UTSW	5	109086617	nonsense	probably null
R5639:Vmn2r12	UTSW	5	109092800	missense	probably benign	0.06
R5753:Vmn2r12	UTSW	5	109091804	missense	probably damaging	1.00
R5797:Vmn2r12	UTSW	5	109085870	nonsense	probably null
R6142:Vmn2r12	UTSW	5	109092897	missense	probably benign
R6162:Vmn2r12	UTSW	5	109086564	missense	probably damaging	0.99
R6176:Vmn2r12	UTSW	5	109086000	missense	probably benign	0.43
R6853:Vmn2r12	UTSW	5	109092905	missense	probably damaging	1.00
R7238:Vmn2r12	UTSW	5	109097789	missense	possibly damaging	0.81
R7341:Vmn2r12	UTSW	5	109086247	missense	possibly damaging	0.74
R7341:Vmn2r12	UTSW	5	109091945	missense	possibly damaging	0.95
R7383:Vmn2r12	UTSW	5	109092818	missense	probably benign	0.19
R7740:Vmn2r12	UTSW	5	109091749	missense	probably damaging	1.00
R7749:Vmn2r12	UTSW	5	109086054	missense	probably damaging	0.99
R7861:Vmn2r12	UTSW	5	109087963	missense	probably benign	0.00
R7908:Vmn2r12	UTSW	5	109086441	missense	probably damaging	1.00
R8128:Vmn2r12	UTSW	5	109091881	missense	possibly damaging	0.81
R8175:Vmn2r12	UTSW	5	109090483	missense	probably damaging	0.97
R8234:Vmn2r12	UTSW	5	109086208	missense	probably benign	0.01
R8771:Vmn2r12	UTSW	5	109092086	missense	possibly damaging	0.95
R8947:Vmn2r12	UTSW	5	109086656	missense	possibly damaging	0.64
R8991:Vmn2r12	UTSW	5	109086167	nonsense	probably null
R9116:Vmn2r12	UTSW	5	109086019	missense	probably damaging	1.00
R9122:Vmn2r12	UTSW	5	109093044	missense	probably benign	0.00
R9153:Vmn2r12	UTSW	5	109086337	missense	probably damaging	1.00
R9371:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R9375:Vmn2r12	UTSW	5	109086120	missense	probably damaging	1.00
R9524:Vmn2r12	UTSW	5	109091957	missense	probably damaging	1.00
R9587:Vmn2r12	UTSW	5	109091456	missense	probably damaging	0.99
Z1088:Vmn2r12	UTSW	5	109092780	missense	probably benign
Z1176:Vmn2r12	UTSW	5	109091437	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTGAGCTTGAAAGCCATGAGCAC -3'
(R):5'- ACTATGCCTGCACACTACACTTGTC -3'

Sequencing Primer
(F):5'- ATACTCCAAATGTGGTCTGCTG -3'
(R):5'- GCACACTACACTTGTCTGTGAG -3'

Posted On

2014-02-11