Incidental Mutation 'R1349:Wdr73'
ID156602
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene NameWD repeat domain 73
Synonyms2410008B13Rik, 1200011I23Rik
MMRRC Submission 039414-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80890723-80901269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80893252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 176 (V176L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026816
AA Change: V203L

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: V203L

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect probably damaging
Transcript: ENSMUST00000146402
AA Change: V176L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: V176L

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCAGTGACACGTTCTCAACAGTACC -3'
(R):5'- ATGCTGGGGAAACCTGGAGCATAC -3'

Sequencing Primer
(F):5'- TAGCCAAGCAGTTGTCCAG -3'
(R):5'- TGGAGCATACAGTGCCAAC -3'
Posted On2014-02-11