Incidental Mutation 'R1349:Cd209d'
ID156603
Institutional Source Beutler Lab
Gene Symbol Cd209d
Ensembl Gene ENSMUSG00000031495
Gene NameCD209d antigen
SynonymsSIGN-R3, mSIGNR3, SIGNR3
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3871824-3878555 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 3878515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011445] [ENSMUST00000209176]
Predicted Effect probably benign
Transcript: ENSMUST00000011445
SMART Domains Protein: ENSMUSP00000011445
Gene: ENSMUSG00000031495

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
CLECT 106 227 2.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209176
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite decreased T and B cell proliferation and extramedullary hematopoiesis in the spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Cd209d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Cd209d APN 8 3877974 splice site probably null
IGL01707:Cd209d APN 8 3878296 missense probably benign
IGL02864:Cd209d APN 8 3877122 missense probably benign 0.08
IGL03066:Cd209d APN 8 3878437 critical splice donor site probably null
IGL03297:Cd209d APN 8 3878476 missense possibly damaging 0.92
R0324:Cd209d UTSW 8 3878258 missense probably benign 0.31
R1335:Cd209d UTSW 8 3872027 missense probably damaging 1.00
R1372:Cd209d UTSW 8 3878515 unclassified probably benign
R1507:Cd209d UTSW 8 3878453 missense possibly damaging 0.72
R1673:Cd209d UTSW 8 3877113 missense probably damaging 1.00
R2393:Cd209d UTSW 8 3878436 critical splice donor site probably null
R2567:Cd209d UTSW 8 3876327 missense probably damaging 1.00
R4907:Cd209d UTSW 8 3877948 missense probably benign 0.01
R5349:Cd209d UTSW 8 3878320 missense probably benign 0.00
R5768:Cd209d UTSW 8 3871968 missense probably benign 0.05
R5949:Cd209d UTSW 8 3877949 missense possibly damaging 0.50
R5953:Cd209d UTSW 8 3877979 splice site probably null
R6103:Cd209d UTSW 8 3878304 missense probably damaging 1.00
R7382:Cd209d UTSW 8 3877965 nonsense probably null
X0025:Cd209d UTSW 8 3877961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCCATCTCCCAGGACTGAATGAG -3'
(R):5'- GGCTCTCCAATCCTTAGCACAAGTG -3'

Sequencing Primer
(F):5'- AGGATCTCAACTTCAATTTCCCAGG -3'
(R):5'- GGTGTCCCATAAATTTGGTCAC -3'
Posted On2014-02-11