Incidental Mutation 'R1349:Hp'
ID156604
Institutional Source Beutler Lab
Gene Symbol Hp
Ensembl Gene ENSMUSG00000031722
Gene Namehaptoglobin
SynonymsHP-1, preHP2, zonulin
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109575128-109579172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 109575306 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 337 (K337Q)
Ref Sequence ENSEMBL: ENSMUSP00000074436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034159] [ENSMUST00000074898] [ENSMUST00000178445]
Predicted Effect probably benign
Transcript: ENSMUST00000034159
SMART Domains Protein: ENSMUSP00000034159
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.6e-58 PFAM
Pfam:Thioredoxin 6 109 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074898
AA Change: K337Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074436
Gene: ENSMUSG00000031722
AA Change: K337Q

DomainStartEndE-ValueType
CCP 33 86 2.9e0 SMART
Tryp_SPc 102 340 4.38e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178445
SMART Domains Protein: ENSMUSP00000137524
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.2e-58 PFAM
Pfam:Thioredoxin 6 110 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212918
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a plasma glycoprotein called haptoglobin that binds free hemoglobin. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta subunits that form a disulfide-linked tetrameric protein that plays an important role in the sequestration and clearance of extracorpuscular hemoglobin. Mice lacking the encoded protein exhibit stunted development of lymphoid organs associated with lower counts of mature T and B cells in the blood and secondary lymphoid compartments. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit partial postnatal lethality, susceptibility to induced acute hemolysis, and altered renal iron loading during aging and after ischemic injury. Homozygotes for a knock-in allele show reduced cholesterol efflux and enhanced nephropathy in STZ-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Hp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Hp APN 8 109575618 splice site probably null
IGL00951:Hp APN 8 109577497 missense possibly damaging 0.71
IGL01013:Hp APN 8 109579021 utr 5 prime probably benign
IGL01096:Hp APN 8 109575401 missense probably benign
IGL01307:Hp APN 8 109575783 missense probably benign 0.05
IGL02997:Hp APN 8 109575786 missense probably damaging 1.00
IGL03378:Hp APN 8 109575707 missense probably damaging 0.99
R1691:Hp UTSW 8 109575572 missense probably benign 0.09
R4741:Hp UTSW 8 109575472 nonsense probably null
R6036:Hp UTSW 8 109576774 splice site probably null
R6036:Hp UTSW 8 109576774 splice site probably null
R6689:Hp UTSW 8 109575720 missense probably benign 0.00
R7426:Hp UTSW 8 109575200 splice site probably null
R7683:Hp UTSW 8 109579099 start gained probably benign
R7943:Hp UTSW 8 109575555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGAGTTTGCATTCAAACTGACC -3'
(R):5'- AGTACCAGGAAGACACCTGCTACG -3'

Sequencing Primer
(F):5'- CTGCTGTAGGCAGTCTATAACAC -3'
(R):5'- GAAGACACCTGCTACGGTGAC -3'
Posted On2014-02-11