Incidental Mutation 'R1349:Ccdc151'
ID156606
Institutional Source Beutler Lab
Gene Symbol Ccdc151
Ensembl Gene ENSMUSG00000039632
Gene Namecoiled-coil domain containing 151
Synonyms
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1349 (G1)
Quality Score198
Status Validated
Chromosome9
Chromosomal Location21989871-22002634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21993620 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 290 (R290H)
Ref Sequence ENSEMBL: ENSMUSP00000110993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044926] [ENSMUST00000045726] [ENSMUST00000115336] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably damaging
Transcript: ENSMUST00000044926
AA Change: R290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041117
Gene: ENSMUSG00000039632
AA Change: R290H

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
coiled coil region 378 420 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045726
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115336
AA Change: R290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110993
Gene: ENSMUSG00000039632
AA Change: R290H

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
coiled coil region 379 421 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 551 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Meta Mutation Damage Score 0.2307 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mico homozygous for an ENU-induced allele exhibit dextrocardia associated with situs inversus totalis and hypoplastic spleen, adrenal anomalies and immotile/dyskinetic tracheal airway cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Ccdc151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ccdc151 APN 9 21995379 critical splice acceptor site probably null
IGL01922:Ccdc151 APN 9 21993530 unclassified probably benign
IGL02223:Ccdc151 APN 9 21993612 missense probably damaging 1.00
IGL03161:Ccdc151 APN 9 22002315 missense probably benign 0.02
IGL03269:Ccdc151 APN 9 21998043 critical splice donor site probably null
R0118:Ccdc151 UTSW 9 21995057 missense probably benign 0.03
R0129:Ccdc151 UTSW 9 21993552 missense probably damaging 0.98
R0279:Ccdc151 UTSW 9 21990247 unclassified probably benign
R0390:Ccdc151 UTSW 9 21991708 missense probably benign 0.00
R1372:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1891:Ccdc151 UTSW 9 21995381 splice site probably null
R2044:Ccdc151 UTSW 9 21991858 missense possibly damaging 0.95
R5116:Ccdc151 UTSW 9 21990128 makesense probably null
R5147:Ccdc151 UTSW 9 21994862 missense probably benign 0.21
R5929:Ccdc151 UTSW 9 22002422 missense possibly damaging 0.50
R6182:Ccdc151 UTSW 9 21990402 missense probably damaging 1.00
R7253:Ccdc151 UTSW 9 22002471 missense probably damaging 1.00
R7498:Ccdc151 UTSW 9 22002257 missense probably damaging 1.00
R7742:Ccdc151 UTSW 9 21992897 missense possibly damaging 0.82
R8331:Ccdc151 UTSW 9 21991711 missense probably damaging 1.00
Z1176:Ccdc151 UTSW 9 21990424 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CGCTTAGCTTAGATGGTGGGGAAC -3'
(R):5'- TCTGGAATACCAAGGGCTCAAGGG -3'

Sequencing Primer
(F):5'- CCTATCCCAGGAAAGAGGCTG -3'
(R):5'- GGACCCTAGTCAGAATCTAATTCTC -3'
Posted On2014-02-11