Incidental Mutation 'R1349:Myo1e'
ID156607
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 70287069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
Predicted Effect probably benign
Transcript: ENSMUST00000034745
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213863
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214767
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGTAGGTAGCAAGGTTGAAACGC -3'
(R):5'- AACACCATCTGGCAGATTAACAGGG -3'

Sequencing Primer
(F):5'- ACGCAAAATCTTTGCTGTGC -3'
(R):5'- CAGAGGTCTTAGCCCCTTAGAATG -3'
Posted On2014-02-11