Incidental Mutation 'R1349:Leo1'
ID156608
Institutional Source Beutler Lab
Gene Symbol Leo1
Ensembl Gene ENSMUSG00000042487
Gene NameLeo1, Paf1/RNA polymerase II complex component
SynonymsLOC235497
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75441524-75466432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75449469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000046905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048937
AA Change: V377A

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046905
Gene: ENSMUSG00000042487
AA Change: V377A

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 33 43 N/A INTRINSIC
low complexity region 64 78 N/A INTRINSIC
internal_repeat_1 82 160 7.97e-7 PROSPERO
internal_repeat_1 177 253 7.97e-7 PROSPERO
low complexity region 255 269 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
Pfam:Leo1 375 537 5.8e-58 PFAM
low complexity region 578 584 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213767
Meta Mutation Damage Score 0.2592 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LEO1, parafibromin (CDC73; MIM 607393), CTR9 (MIM 609366), and PAF1 (MIM 610506) form the PAF protein complex that associates with the RNA polymerase II subunit POLR2A (MIM 180660) and with a histone methyltransferase complex (Rozenblatt-Rosen et al., 2005 [PubMed 15632063]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Leo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Leo1 APN 9 75450480 splice site probably benign
IGL01412:Leo1 APN 9 75466242 missense probably benign 0.08
IGL01789:Leo1 APN 9 75454614 splice site probably benign
IGL02116:Leo1 APN 9 75449415 missense probably damaging 1.00
IGL02303:Leo1 APN 9 75445999 splice site probably benign
FR4449:Leo1 UTSW 9 75450573 critical splice donor site probably benign
FR4976:Leo1 UTSW 9 75450572 critical splice donor site probably benign
R0729:Leo1 UTSW 9 75457138 missense possibly damaging 0.78
R0811:Leo1 UTSW 9 75445549 missense probably benign 0.02
R0812:Leo1 UTSW 9 75445549 missense probably benign 0.02
R0960:Leo1 UTSW 9 75445240 missense probably benign 0.01
R1272:Leo1 UTSW 9 75450513 missense possibly damaging 0.95
R1372:Leo1 UTSW 9 75449469 missense possibly damaging 0.80
R1634:Leo1 UTSW 9 75466260 missense possibly damaging 0.88
R2118:Leo1 UTSW 9 75445812 missense probably damaging 0.99
R2167:Leo1 UTSW 9 75445709 missense probably benign 0.01
R2484:Leo1 UTSW 9 75445473 missense possibly damaging 0.66
R3963:Leo1 UTSW 9 75450480 splice site probably benign
R4628:Leo1 UTSW 9 75445697 missense probably damaging 1.00
R4935:Leo1 UTSW 9 75445877 missense probably benign 0.13
R5590:Leo1 UTSW 9 75457141 missense possibly damaging 0.90
R5875:Leo1 UTSW 9 75450560 missense probably damaging 0.98
R6394:Leo1 UTSW 9 75445470 missense probably benign 0.00
R7203:Leo1 UTSW 9 75445996 splice site probably null
R7472:Leo1 UTSW 9 75448341 missense probably damaging 1.00
R7654:Leo1 UTSW 9 75455679 missense possibly damaging 0.66
R7671:Leo1 UTSW 9 75445562 missense probably benign 0.00
R7998:Leo1 UTSW 9 75445276 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAACCAGACAGTGTTTCTTGTTCCCTT -3'
(R):5'- AGCATGGCTTCACTACAGTGTGAC -3'

Sequencing Primer
(F):5'- CGTAATGAAATGTGGAACTTGAACTG -3'
(R):5'- ggctgtcctggaactcac -3'
Posted On2014-02-11