Incidental Mutation 'R1349:Glipr1'
ID156610
Institutional Source Beutler Lab
Gene Symbol Glipr1
Ensembl Gene ENSMUSG00000056888
Gene NameGLI pathogenesis-related 1 (glioma)
SynonymsRTVP1, RTVP-1, 2410114O14Rik, mRTVP-1
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111985448-112002631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111993532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000123990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074805] [ENSMUST00000161870] [ENSMUST00000162508]
Predicted Effect probably benign
Transcript: ENSMUST00000074805
AA Change: V108A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074359
Gene: ENSMUSG00000056888
AA Change: V108A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159550
Predicted Effect probably benign
Transcript: ENSMUST00000161870
SMART Domains Protein: ENSMUSP00000134094
Gene: ENSMUSG00000056888

DomainStartEndE-ValueType
Pfam:CAP 1 42 9.2e-10 PFAM
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162508
AA Change: V108A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123990
Gene: ENSMUSG00000056888
AA Change: V108A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174201
Meta Mutation Damage Score 0.2065 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to both the pathogenesis-related protein (PR) superfamily and the cysteine-rich secretory protein (CRISP) family. Increased expression of this gene is associated with myelomocytic differentiation in macrophage and decreased expression of this gene through gene methylation is associated with prostate cancer. The protein has proapoptotic activities in prostate and bladder cancer cells. This gene is a member of a cluster on chromosome 12 containing two other similar genes. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene renders mice more vulnerable to spontaneous tumorigenesis, leading to the formation of a wide spectrum of tumors and significantly shorter tumor-free survival times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Glipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Glipr1 APN 10 111985650 missense probably benign
IGL00553:Glipr1 APN 10 111986669 missense possibly damaging 0.79
IGL02391:Glipr1 APN 10 111988894 unclassified probably benign
R0115:Glipr1 UTSW 10 111993541 missense probably benign 0.00
R0486:Glipr1 UTSW 10 111996849 splice site probably benign
R1822:Glipr1 UTSW 10 111996860 missense possibly damaging 0.84
R4364:Glipr1 UTSW 10 111985637 missense possibly damaging 0.84
R4905:Glipr1 UTSW 10 111985640 missense probably damaging 1.00
R4974:Glipr1 UTSW 10 111993506 nonsense probably null
R5734:Glipr1 UTSW 10 111985793 nonsense probably null
R7603:Glipr1 UTSW 10 111988832 missense probably benign 0.07
R8238:Glipr1 UTSW 10 111993440 critical splice donor site probably null
Z1176:Glipr1 UTSW 10 111988837 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACACCAAGTCCAGTTCGTTCCATC -3'
(R):5'- AGTTGAGTAGGCAAACAGCCTTGTG -3'

Sequencing Primer
(F):5'- CTTTAAACAGGTGGTTCCAAGAAGC -3'
(R):5'- CAGTCTTGGGACCCAAAACT -3'
Posted On2014-02-11