Incidental Mutation 'R1349:Ccdc157'
ID156611
Institutional Source Beutler Lab
Gene Symbol Ccdc157
Ensembl Gene ENSMUSG00000051427
Gene Namecoiled-coil domain containing 157
Synonyms
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4141123-4160293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4149056 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 48 (I48N)
Ref Sequence ENSEMBL: ENSMUSP00000099148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093381] [ENSMUST00000101626]
Predicted Effect probably benign
Transcript: ENSMUST00000093381
AA Change: I150N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091074
Gene: ENSMUSG00000051427
AA Change: I150N

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 321 343 N/A INTRINSIC
low complexity region 385 414 N/A INTRINSIC
SCOP:d1fxkc_ 452 595 4e-5 SMART
low complexity region 639 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101626
AA Change: I48N

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099148
Gene: ENSMUSG00000051427
AA Change: I48N

DomainStartEndE-ValueType
low complexity region 219 241 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
SCOP:d1fxkc_ 350 493 3e-4 SMART
low complexity region 537 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139099
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Ccdc157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ccdc157 APN 11 4148781 missense probably damaging 1.00
IGL02267:Ccdc157 APN 11 4144035 missense probably benign 0.00
IGL03182:Ccdc157 APN 11 4151832 missense probably damaging 1.00
R0282:Ccdc157 UTSW 11 4146708 missense probably damaging 0.98
R0360:Ccdc157 UTSW 11 4146663 missense probably damaging 0.98
R1527:Ccdc157 UTSW 11 4151795 missense probably damaging 1.00
R1691:Ccdc157 UTSW 11 4149030 missense probably benign 0.07
R1932:Ccdc157 UTSW 11 4146549 missense probably damaging 1.00
R2132:Ccdc157 UTSW 11 4150004 missense probably damaging 1.00
R4361:Ccdc157 UTSW 11 4146550 missense probably damaging 0.99
R4754:Ccdc157 UTSW 11 4148994 missense possibly damaging 0.46
R4786:Ccdc157 UTSW 11 4151861 missense probably damaging 1.00
R5314:Ccdc157 UTSW 11 4150078 nonsense probably null
R5564:Ccdc157 UTSW 11 4148765 missense probably damaging 1.00
R5625:Ccdc157 UTSW 11 4151888 missense probably damaging 0.99
R5898:Ccdc157 UTSW 11 4144538 missense probably benign 0.23
R6193:Ccdc157 UTSW 11 4151912 missense probably damaging 1.00
R6936:Ccdc157 UTSW 11 4144030 missense probably benign
R7057:Ccdc157 UTSW 11 4144586 missense probably benign 0.33
R7113:Ccdc157 UTSW 11 4148889 missense possibly damaging 0.94
R7136:Ccdc157 UTSW 11 4148592 missense possibly damaging 0.94
T0975:Ccdc157 UTSW 11 4146246 missense probably damaging 0.99
Z1177:Ccdc157 UTSW 11 4146547 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTCTGACACAGGCTGATAACAAC -3'
(R):5'- AGCCATTGCTGTGACTGATACCG -3'

Sequencing Primer
(F):5'- CTGGTGCAAGCATCACAGG -3'
(R):5'- CTAGGGTGCGAGCAGAGAG -3'
Posted On2014-02-11