Incidental Mutation 'R1349:Htr1a'
ID156618
Institutional Source Beutler Lab
Gene Symbol Htr1a
Ensembl Gene ENSMUSG00000021721
Gene Name5-hydroxytryptamine (serotonin) receptor 1A
Synonyms5-HT1A receptor, Gpcr18
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location105443639-105448122 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105445366 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 371 (C371*)
Ref Sequence ENSEMBL: ENSMUSP00000022235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022235]
Predicted Effect probably null
Transcript: ENSMUST00000022235
AA Change: C371*
SMART Domains Protein: ENSMUSP00000022235
Gene: ENSMUSG00000021721
AA Change: C371*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 45 174 2.7e-5 PFAM
Pfam:7TM_GPCR_Srsx 47 236 8e-8 PFAM
Pfam:7tm_1 53 400 1.3e-88 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygotes for targeted null mutations show a common phenotype, including augmented anxious-like behavior in the elevated plus-maze, open-field, and novel object tests, reduced immobility in the forced-swim or tail-suspension test, and changes in density of 5-HTT binding in several brain regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Htr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Htr1a APN 13 105445284 missense possibly damaging 0.88
R0578:Htr1a UTSW 13 105445087 missense probably damaging 1.00
R0919:Htr1a UTSW 13 105444836 missense probably damaging 1.00
R0962:Htr1a UTSW 13 105444324 missense probably benign 0.02
R1143:Htr1a UTSW 13 105445068 missense probably benign
R1550:Htr1a UTSW 13 105445280 missense probably benign 0.09
R2520:Htr1a UTSW 13 105445373 missense probably benign 0.43
R3794:Htr1a UTSW 13 105444344 missense possibly damaging 0.59
R6679:Htr1a UTSW 13 105445428 missense probably damaging 1.00
R6844:Htr1a UTSW 13 105444947 missense possibly damaging 0.94
R7680:Htr1a UTSW 13 105445031 missense probably benign
Z1177:Htr1a UTSW 13 105444876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGAAGAGCCTGAATGGTCAGC -3'
(R):5'- TCATCAGCGGCAGAACTTGCAC -3'

Sequencing Primer
(F):5'- GAATCAGGAGCTACCTCCTATGTC -3'
(R):5'- CGGCAGAACTTGCACTTGATG -3'
Posted On2014-02-11